Distribución y aspectos poblacionales del lobo Ibérico (Canis lupus signatus) en las provincias de Pontevedra y A Coruña (Galicia)

Para determinar el área de distribución del lobo en las provincias de Pontevedra y A Coruña se realizaron itinerarios de muestreo y se enviaron cuestionarios a los Agentes de Medio Ambiente de la Xunta de Galicia y a las Sociedades de Cazadores del área de estudio. Los resultados se representaron en cuadrículas U.T.M. 10x10 Km. Se ha confirmado la presencia del lobo en el 67,05% de las cuadrículas del área de estudio. La especie se distribuye de forma continua en ambas provincias, donde estimamos un área de distribución de 6.400 km2 en la provincia de A Coruña y 3.200 km2 en la de Pontevedra, ocupando principalmente el área montañosa de la Dorsal Gallega y el occidente de A Coruña; esta última zona está conectada con el resto del área de distribución del lobo en Galicia a través del norte de la provincia de Pontevedra. Para la localización de las manadas se muestreó el territorio a nivel de cuadrícula U.T.M. 10x10 Km, y en las zonas donde se detectó una mayor concentración de indicios, se realizaron estaciones de escucha y espera con el fin de localizar la presencia de manadas (cachorros y adultos). Se determinó la presencia de 29 manadas (14 en la provincia de A Coruña y 15 en Pontevedra), de las cuales se confirmó la reproducción del 52%. Se ha estimado un tamaño poblacional para la provincia de A Coruña entre 87-129 lobos (1,36-2,02 lobos/100 Km2) y entre 95-140 para la provincia de Pontevedra (2,97-4,38 lobos/100 Km2). Las zonas de mayor densidad se localizaron en la Dorsal Gallega. Se han localizado algunas manadas en áreas muy humanizadas, lo que podría explicar que la principal causa de mortalidad conocida entre enero de 2000 y octubre de 2003 (n=29) sea el atropello (n=21)

Never to me! Concealment of intimate partner violence in Querétaro, Mexico

The study examines the concealment of intimate partner violence (IPV) involving men and women of different sexual orientation in Querétaro, Mexico. Grounded Theory was used to analyze both semi-structured interviews (for n = 43) and photointerventions(for n = 18). One of the main factors associated with the concealment of IPV is gender stereotype, which in turn influences the application of justice and the beliefs grounded in idyllic love. Other factors include youth, social stigmatization of violence, fear of loss of relationships, damaging effects on children, and social isolation. The findings reveal that IPV concealment is a common practice among men and women of different sexual orientation. Hence, increased efforts in the development of an inclusive public policy to address these problems should be undertake

Isolation and Identification of Endophytic Fungi from Hypocrea pachybasioides and Investigation of the Fungi Cytotoxic Activities

Background and Objective: In the present study, a wild fungus, Hypocrea pachybasioides, has molecularly identified using ribosomal ITS5-ITS4 region as well as analysis of chemically functional groups. This fungus grows on rotten woods. This study is the first report on chemical and pharmacological activities of the fungus. The Hypocrea genus has been linked to another fungus such as Trichoderma spp., which makes it important to identify this species. There are no studies on the fungus chemical and pharmacological characteristics. The aim of the study was to identify a wild fungus through molecular methods, as well as its chemical and pharmacological identification. Material and Methods: Compounds from methanolic extract of the mycelium and those secreted in the culture broth were assessed. First, fungal deoxyribonucleic acid was extracted for molecular identification. Qualitative assessments were carried out for compounds such as tannins, saponins and coumarins, as well as quantitative assessments for total phenols and flavonoids. High-pressure liquid chromatography analysis was carried out for organic acids. Furthermore, antiproliferative assessments were carried out using sulforhodamine B method. Results and Conclusion: Assessments carried out on both fractions showed that compounds such as alkaloids and saponins included the highest quantities in the suggested hedonic scale. In contrast, anthraquinones were detected in lower quantities, while coumarins and tannins were not detected. Methanolic extract from mycelia showed cytotoxic activity in HeLa cell line. Therefore, Hypocrea pachybasioides can be addressed as a candidate for further pharmacological studies based on the criteria from the National Institutes of Health of the United States. This is suggested as a potentially biotechnological model for identifying various metabolites with therapeutic characteristics. Conflict of interest: The authors declare no conflict of interest.   Introduction   Hypocrea is a genus of fungi belonging to the class of Ascomycetes. Its species are saprophytes and predators of other fungi. There are 509 species belonging to Hypocrea genus, most of them identified by their morphological characteristics. These fungi are widely distributed and grow in tropical, subtropical, moist, arid, temperate and boreal forests. They are brightly or slightly colored and can develop on rotten woods in the form of a shelf. These fungi have been associated with other species of Ascomycota and Basidiomycota of the anamorphic type [1]. Furthermore, Hypocrea (H.) is linked to the anamorphic fungi of Trichoderma spp. since all species have been reported as phylogenetically relatives [1, 2]. All these characteristics make difficulties to identify several species belonging to Hypocrea [2]. Thus, molecular methods are useful tools for the identification of these fungi with phenotypic and genotypic complexities within the species of Hypocrea/ Trichoderma. Molecular identification is important since several species of Hypocrea (anamorph to Trichoderma) have shown activities against pathogenic fungal species such as Phytium spp., Rhizoctonia solani and Verticillium dahliae. Moreover, they can act on Botrytis cinerea, which causes the root rot of forest species, suggesting protective roles to avoid decay in fruit storage [3]. Biological control by Hypocrea spp. was verified in the treatment of pathogenic species such as Fusarium spp. of tomato crops [4]. Similarly, it has been demonstrated that the fungi synthesize chemical compounds that accelerate growth of various vegetable crops. Lo and Lin (2002) [5] reported positive effects on soil using Trichoderma (T.) harzianum for the cultivation of squash and cucumbers while Keswani et al. (2014) reported that Trichoderma spp. secreted several compounds that acted as growth regulators for horseradish, tomato, rice and tobacco [6]. In contrast, studies on compounds secreted by Hypocrea spp. have not been carried out. Since other genera such as Trichoderma are anamorph, it has been suggested that Hypocrea spp. possibly produce various compounds with simple or complex molecular structures and various chemical-biological characteristics. Secondary metabolites such as lignans, flavonoids, phenols, terpenes, sterols, alkaloids, coumarins and antibiotics with various biological characteristics can provide novel uses in various sectors of food, agrochemical and pharmaceutical industries [7]. In the present study, a wild fungus was isolated and identified as H. pachybasioides by molecular approaches. Contents of chemically functional groups such as alkaloids, saponins, anthraquinones, coumarins and tannins were analyzed as well. Moreover, total phenols and flavonoids were assessed in extracts from mycelia and those secreted into the culture broth. The cytotoxic effects of these metabolites were also investigated in three different human tumor cell lines. These data may be useful for further isolations of H. pachybasioides metabolites as potential biotechnological compounds. Materials and Methods 2.1. Fungus collection Fungi used in this study were collected from the Sierra de Tequexquinahuac, Texcoco, Estado de Mexico. Taxo-nomic identification was carried out in the Fungi Laboratory of the Universidad Autonoma Chapingo. 2.2. Culture conditions Collected fungi were disinfected in 1% sodium hypochlorite (v/v) solution for 10 min and then transferred into sterile distilled water (DW) (30 ml) to remove excess sodium hypochlorite. A slice of the fungi was transferred into a Petri dish with potato dextrose agar (PDA) media and incubated at 25 °C for a week (w). After growing the fungi on the plate, a mycelial disk was inoculated into 100 ml of potato dextrose broth (PDB) media and incubated at 25 °C for a week (w). Mycelia were separated from the culture media via filtration and incubated at 35 °C for 3 d. Dehydrated mycelia were pulverized using mortar and then 20 mg of the sample were used for the isolation of DNA. 2.3. DNA extraction Briefly, DNA extraction was carried out using AxyPrep multisource genomic DNA miniprep kit (cat. AP-MN-MS-GDNA-50, Axygen, Union City, CA, USA), based on the manufacturer’s instructions. The DNA integrity was visualized on 0.7% (w/v) agarose gels stained with GelRed (Nucleic Acid Gel, Biotium; Hayward, CA, USA) using MultiDoc-It (UVP; Upland, CA, USA). 2.4. Amplification of the ITS region using PCR The PCR reactions were prepared using the primer pair of ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAA) [9]. The reaction contained 40 ng of genomic DNA, Vent enzyme buffer (1×), MgCl2 (1.5 mM), dNTPs (0.2 mM), primers (each 0.2 μM) and 1.25 U of Vent polymerase enzyme (BioLabs, New England Biolad, Ipswich, MA, USA) in a final volume of 50 µl. Amplification of the genes was carried out using Axigen thermal cycler (Axygen MaxyGene II Thermal Cycler, CA, USA) under the following conditions of one cycle at 94°C for 5 min, 30 cycles at 94°C for 30 s; 5 °C for 45 s and 72°C for 1 min and then one cycle at 72 °C for 5 min. Amplicons were electrophoresed on 2% (w/v) agarose gels. 2.5. Molecular identification of Hypocrea pachybasioides The amplified PCR products of the ITS region were cloned into the vector of pJET1.2/blunt (Thermo Scientific, USA) to achieve a complete sequence of the analyzed and unknown regions. Vectors with the inserts were transformed into competent Escherichia coli Top 10F´ cells (Invitro-genTM, Waltham, MA, USA). Plasmid DNA was extracted using the GeneJET plasmid miniprep kit (Thermo Scientific, Waltham, MA, USA) based on the manufac-turer's instructions. Positive clones were verified through digestion with BglII to release a 550-bp fragment. In addition, clones were sequenced using primers of pJET forward (CGACTCACTATAGGGAGAGCGGC) and pJET Reverse (AAGAACATCGATTTTCCATGGCAG), which was carried out at the Instituto de Biotecnología of the Universidad Autonoma Nacional de Mexico. The sequence was analyzed through sequence comparisons of the GenBank database (NCBI) using Blast algorithm [10].     2.6. Extracellular and intracellular fungal extracts To assess presence of chemically functional compounds e.g. alkaloids, anthraquinones, tannins, volatile coumarins and saponins. Methanol was used to achieve two extracts from the collected fungi, one from the concentrated culture broth (extracellular) and the other one from the mycelia (intracellular). Total phenolics and flavonoids were quanti-fied in the two samples. Moreover, methanol was used to isolate the metabolites. Erlenmeyer flasks with 100 ml of PDB media were inoculated with fungal mycelia and incubated at 25 °C for 10 d. Then, mycelia were separated from the culture media by filtration. Mycelia and filtered broth were dried in an oven at 35 °C for 3 d. Dried mycelia were pulverized using mortar and trans-ferred into 50 ml of methanol for 1 w. Methanolic extract was concentrated under decreased pressure using rotary evaporator. 2.7. Detection of alkaloids and anthraquinones Thin layer chromatography (TLC) was carried out using silica gel plaques with dimensions of 3 × 5 cm (60F254) and results revealed presence of alkaloids and anthraquinones using Dragendorff reagent and UV light, respectively. An aliquot (0.5 μl) of the extract was transferred onto a plate and set in a solvent system of dichloromethane-methanol (95:5). Alkaloids were verified by the appearance of brown-red spots using Dragendorff reagent. Anthraquinones were investigated with the typical yellow or red fluorescent coloring after exposing the plates to UV light [11]. 2.8. Detection of tannins and saponins To analyze tannins in the extracts, three various solutions (10 mL) were prepared, including % (w/v) Tube 1, 1% gelatin solution; Tube 2, 1% gelatin solution and 10% NaCl; and Tube 3, 10% NaCl. Then, 2 ml of the extract were transferred into each tube and vigorously mixed using vortex. White precipitate in Tubes 1 and 2 indicated presence of tannins [11]. To assess saponins in the fungal extract, 2 ml of the samples were transferred into 10 ml of water. Tubes were heated 30 min at 80 °C and then set to cool down at room temperature (RT) and then stirred vigorously. Presence of stable foams within 15–20 min indicated presence of saponins [11]. 2.9. Quantification of total phenols To assess total phenols in the extracts, Folin-Ciocalteu reagent was used based on a protocol by [12]. Results were expressed as mg gallic acid/g dry extract (mgGAE/g) [12]. 2.10. Quantification of total flavonoids The flavonoid content was assessed using standard quercetin following the protocol [12]. Results were reported in mg quercetin/g dry extract (mgQE/g) [12].     2.11. Analysis of organic acids Briefly, D,L-malic, oxalic and tartaric organic acids were detected in the fungal extracts using a methodology developed by [13]. Technically, 20 μl of three various samples were analyzed, including mycelia, filtered broth or the organic acid standards, which were injected into HPLC  of Agilent Technology model 1260 equipped with a quaternary pump (Agilent Technology, California, USA) with a multiple wavelength detector (MWD). The column included an X-Terra MS C18 column, 5 μm (4.6 × 250 mm) and the mobile phase consisted of phosphate buffer (50 mM, pH 2.8) in isocratic mode. The flow was adjusted to 0.7 ml/ min. Results were recorded at 210 nm and used in a standard curve. Results were expressed as parts per million. 2.12. Antiproliferative activity assay To assess cytotoxic effects of H. pachybasioides extracts in human epithelial carcinoma (HeLa). Cell line was incubated at 37 °C in a humidified atmosphere of 5% CO2 and 100% air in complete RPMI 1640 media. Cells in the log growth phase were treated with three various concentrations of methanolic extract from the mycelia in a range of 0.032–20.0 μg/ml and incubated at 37 °C for 72 h under similar culture conditions. Each experiment was carried out in triplicate and colchicine positive control was used as an inhibitor of cell division. Cell concentration was assessed using colorimetric method and sulforhodamine B. Results were expressed as percentage of cell growth using the formula of cellular growth (%) = (At - Ab) / (Ac - Ab) × 100. Where, At was the average OD of the treatment, Ac was the average OD of the control and Ab was the average of the initial growth OD (blank) [14]. 2.13. Statistical analysis Linear regression analysis of the semi-logarithmic graphs between the concentrations and percentages of the cell growth was used. Effective concentration of the compound needed to inhibit cell proliferation by 50% (IC50 in µg/ml) was assessed using Sigma plot software [15]. Results and Discussion 3.1. Fungus molecular identification Molecular identification of the fungi usually uses nuclear DNA markers (18S and 28S ribosomal genes), spacer regions such as ITS 1 and ITS 2, external ETS and IGS intergenic [16]. Although, most of the reports on fungi identification have used the ITS region. Several genomic regions within the ITS region have been standardized and are now referred to as DNA barcodes. These barcodes are short regions, typically 400–800 base pairs (bp) [17], facilitating molecular identification of fungi. This includes anamorphic fungi, which can particularly be challenging to identify [18]. In this study, the ITS4-ITS5 region was used, including ribosomal gene region of 5.8S (Fig. 1A). Fragment was achieved using ITS 4 forward and ITS 5 reverse primers, resulting in an amplicon of 450 bp within the expected range (Fig. 1B) [17]. Gimenez-Pereira et al. reported use of the ITS region to molecularly identify H. pseudokoningii within other filame-ntous fungi [19]. Then, the band obtained was cloned into the pJet 1.2 vector and sequenced using pJet forward and pJet reverse primers. Then, data were analyzed using Gen Bank database of the National Center for Biotechnology Information (NCBI), showing 99% identity and value of 0.0 with the sequence corresponding to H. pachybasioides (GU062213.1). This result helped molecular identification of the collected strain and a phylogenetic tree was construc-ted to show proximity of H. pachybasioides to other strains from similar species, demonstrating its close relationship majorly with other fungi of Trichoderma spp. (Fig. 2). 3.2. Chemically functional groups Compounds such as saponins, tannins, coumarins, alkaloids, anthraquinones in the methanolic extracts from the mycelia and filtered culture media of H. pachybasioides were assessed. All these compounds have been investigated in various organisms because they include pharmacological activities. For example, alkaloids have been used as anticancer, antimicrobial, antiparasitic, antidepressant, anti-malarial, anticonvulsant and antineurodegenerative agents. Anthraquinones are other molecules associated to antiviral, analgesic, diuretic, anticancer, anti-inflammatory, anti-microbial, antiparasitic, vasorelaxant and cathartic activities [20]. Furthermore, tannins may show antitumor, anti-microbial and antioxidant activities [21]. Coumarins have been reported to include anticancer, coagulant, antiedema, anti-hypertensive, anti-hypercholesterolemic, anticoagul-ant, antimicrobial, antiviral and antihypertensive activities [22]. Saponins have shown anticancer, antidiabetic, antiviral, antiallergic, antihypercholestero-lemic, antimicro-bial and antiparasitic activities [23]. Presence of these compounds in the methanolic extracts allowed the current authors to report the first approach on the chemical compounds produced by this fungus. In mycelia, presence of alkaloids was detected at a moderate concentration, while saponins and anthraquinones were detected at lower concentrations. However, the broth extract included a large quantity of saponins and alkaloids (Table 1). Presence of the chemically functional groups highly suggests that some might present a therapeutic activity. Organic acids such as ascorbic, D,L-malic, oxalic and tartaric were enriched in the broth extract, compared to the mycelia, and presented a similar magnification as the juice extracted from Stenocereus stellatus [13] [24]. 3.3. Total phenols and flavonoids quantifications Total phenols and flavonoids were quantified, which might include significant effects on cells [24]. Quantities of total phenols and flavonoids were lower in culture broth, compared to the extract from mycelia, both from a methanolic extract (Table 1). 3.4. Cytotoxic analysis To assess pharmacological activities, cytotoxic assess-ments were carried out using the methanolic extract from the mycelia on cell lines of MCF-7, HeLa and HCT15. So, the half maximal inhibitory concentration (IC50) was calculated by fitting curves of data from the sulforhodamine B assay (Table 1), where the antiproliferative effect was reported. Colchicine was used as control. Results showed that HeLa was the most sensitive cell line to the extract with an IC50 of 12.9 ppm while no activity was detec-ted in MCF-7 and HCT15 cells, less than 20 ppm in the assessed range. The IC50 was established as a criterion for cytotoxic activity of the crude extracts by the US national cancer institute; in which, range of 0-20 ppm is cytotoxic [25]. 3.5. Relationships between the chemical compounds and cytotoxic assay Use of fungi for the extraction of various compounds of nutritional and medicinal importance has extensively been studied. Although fungi are primary microorganisms producing metabolites, a few studies have focused on the analysis of chemically functional groups in the fungi. Compounds with pharmacological activity have already been identified and characterized. Saponins are used as compounds with antifungal activity such as strobilurins and oudesmansins present in basidiomycetes and ascomycetes. Endophytic fungi of medicinal plants such as Nectria, Aspergillus, Fusarium, Verticillium, Engyodontium, Plectosphaerella, Penicillium and Cladospori include these compounds, showing antifungal and antibacterial activities. Furthermore, these fungi are industrial materials to produce saponins with antimicrobial activity for use in health and agricultural sectors [26], It is noteworthy that these treatments are mostly used as mixtures. It is possible to improve effects of nano transporters [27]. It is well known that phenolics include antioxidant capacity. In this study, total phenolic compounds and flavonoids were assessed and the quantity was higher in mycelia than broth. In plants, most of the phenolics are in detected in the cytosol. This explains differences between the mycelia and broth extracts since the mycelial extract suffers cell disruption. It is useful to carry out studies on the antioxidant capacity of H. pachybasioides, as reported by Zeng et al., 2011 in two Hypocrea spp. [28]. Alkaloids include pharmacological activities such as antimicrobial, insecticidal, cytotoxic, vasoconstrictive, anti-hemorrhagic and anticancer activities. For example, ergometrine and ergoline from Claviceps spp. have shown vasoconstricting and anti-hemorrhagic activities and are used for migraine treatment. Oxalin extracted from P. oxalicum is an alkaloid with strong cytotoxic activity similar to taxol that is reported to arrest the cell cycle in M phase [29]. Reports of anthraquinones with pharmacological effects on fungi are little; however, tetrahydro-anthraquinone of Alternaria sp. XZSBG-1 has shown cytotoxic activity on cell lines of HCT-16 and HeLa while 6-8-di-O-methylveranthine isolated from A. versicolor EN-7 has shown antibacterial effects on E. coli and Staphylococcus aureus. Furthermore, T. aureoviride PSU-F95 produces two anthraquinones: coniotrantra-quinone-1 and emodine, which inhibit the growth of resistant strains of S. aureus [30]. These studies support results of the current study because with the extract from the mycelia, it was possible to report important cytotoxic activities for HeLa cell lines. Further studies are recommended to isolate specific metabolites in H. pachybasioides. Compounds with higher cytotoxic activities isolated from fungi are polysaccharides and heteropolysaccharides, which include high solubility in water and alcohols. These present better results when assessed with in vitro models on cancer cell lines [31]. The current results are aligned with this idea because it has been observed that methanolic extract of the H. pachybasioides mycelia includes antiproliferative activity for HeLa cell line. Trichoderma spp. produce such effects in Hela and HCT-7 cell lines [32]. Another important example is lipopeptaibols isolated from T. strigosum that have shown activity against various cell lines, including HCT-116 [33]. Cytotoxic activity of H. pachybasioides mycelia might be associated to high phenol contents, as occurs in S. stellatus extracts previously achieved in the current authors’ laboratory. It is suggested that phenols enhance antioxidant activity in cells. Correlations have been made between the cytotoxic effects and total phenols, antioxidant activities and cytotoxicity using the following formula: “Antioxidant capacity = a * phenols + b * D_malic + c * glucose; where, a = 0.54, b = 0.56, c = 0.28 (standard errors = 0.19, 0.20 and 0.21, respectively) and R = 0.76” [22]. This correlation with data was achieved from peels of tropical fruits: Annona squamosa L. (purple sugar apple), A. reticulata L. (custard apple), Chrysophyllum cainito L. (green star apple) and Melicoccus bijugatus Jacq. (mamoncillo) with a correlation with r2 = 0.97 (p = 0.05) with total phenols [24,34]. Conclusion In this study, a wild fungus was identified as H. pachybasioides using molecular approaches. A general study was carried out to assess various metabolites. It has been shown that methanolic extract from the myce

TRY plant trait database - enhanced coverage and open access

Plant traits-the morphological, anatomical, physiological, biochemical and phenological characteristics of plants-determine how plants respond to environmental factors, affect other trophic levels, and influence ecosystem properties and their benefits and detriments to people. Plant trait data thus represent the basis for a vast area of research spanning from evolutionary biology, community and functional ecology, to biodiversity conservation, ecosystem and landscape management, restoration, biogeography and earth system modelling. Since its foundation in 2007, the TRY database of plant traits has grown continuously. It now provides unprecedented data coverage under an open access data policy and is the main plant trait database used by the research community worldwide. Increasingly, the TRY database also supports new frontiers of trait-based plant research, including the identification of data gaps and the subsequent mobilization or measurement of new data. To support this development, in this article we evaluate the extent of the trait data compiled in TRY and analyse emerging patterns of data coverage and representativeness. Best species coverage is achieved for categorical traits-almost complete coverage for 'plant growth form'. However, most traits relevant for ecology and vegetation modelling are characterized by continuous intraspecific variation and trait-environmental relationships. These traits have to be measured on individual plants in their respective environment. Despite unprecedented data coverage, we observe a humbling lack of completeness and representativeness of these continuous traits in many aspects. We, therefore, conclude that reducing data gaps and biases in the TRY database remains a key challenge and requires a coordinated approach to data mobilization and trait measurements. This can only be achieved in collaboration with other initiatives

Seasonal drought limits tree species across the Neotropics

Within the tropics, the species richness of tree communities is strongly and positively associated with precipitation. Previous research has suggested that this macroecological pattern is driven by the negative effect of water-stress on the physiological processes of most tree species. This process implies that the range limits of taxa are defined by their ability to occur under dry conditions, and thus in terms of species distributions it predicts a nested pattern of taxa distribution from wet to dry areas. However, this ‘dry-tolerance’ hypothesis has yet to be adequately tested at large spatial and taxonomic scales. Here, using a dataset of 531 inventory plots of closed canopy forest distributed across the Western Neotropics we investigated how precipitation, evaluated both as mean annual precipitation and as the maximum climatological water deficit, influences the distribution of tropical tree species, genera and families. We find that the distributions of tree taxa are indeed nested along precipitation gradients in the western Neotropics. Taxa tolerant to seasonal drought are disproportionally widespread across the precipitation gradient, with most reaching even the wettest climates sampled; however, most taxa analysed are restricted to wet areas. Our results suggest that the ‘dry tolerance’ hypothesis has broad applicability in the world's most species-rich forests. In addition, the large number of species restricted to wetter conditions strongly indicates that an increased frequency of drought could severely threaten biodiversity in this region. Overall, this study establishes a baseline for exploring how tropical forest tree composition may change in response to current and future environmental changes in this region

Seasonal drought limits tree species across the Neotropics

AcceptedArticle in Press© 2016 Nordic Society Oikos.Within the tropics, the species richness of tree communities is strongly and positively associated with precipitation. Previous research has suggested that this macroecological pattern is driven by the negative effect of water-stress on the physiological processes of most tree species. This implies that the range limits of taxa are defined by their ability to occur under dry conditions, and thus in terms of species distributions predicts a nested pattern of taxa distribution from wet to dry areas. However, this 'dry-tolerance' hypothesis has yet to be adequately tested at large spatial and taxonomic scales. Here, using a dataset of 531 inventory plots of closed canopy forest distributed across the western Neotropics we investigated how precipitation, evaluated both as mean annual precipitation and as the maximum climatological water deficit, influences the distribution of tropical tree species, genera and families. We find that the distributions of tree taxa are indeed nested along precipitation gradients in the western Neotropics. Taxa tolerant to seasonal drought are disproportionally widespread across the precipitation gradient, with most reaching even the wettest climates sampled; however, most taxa analysed are restricted to wet areas. Our results suggest that the 'dry tolerance' hypothesis has broad applicability in the world's most species-rich forests. In addition, the large number of species restricted to wetter conditions strongly indicates that an increased frequency of drought could severely threaten biodiversity in this region. Overall, this study establishes a baseline for exploring how tropical forest tree composition may change in response to current and future environmental changes in this region.This paper is a product of the RAINFOR and ATDN networks and of ForestPlots.net researchers (http://www.forestplots.net). RAINFOR and ForestPlots have been supported by a Gordon and Betty Moore Foundation grant, the European Union’s Seventh Framework Programme (283080, ‘GEOCARBON’; 282664, ‘AMAZALERT’); European Research Council (ERC) grant ‘Tropical Forests in the Changing Earth System’ (T-FORCES), and Natural Environment Research Council (NERC) Urgency Grant and NERC Consortium Grants ‘AMAZONICA’ (NE/F005806/1) and ‘TROBIT’ (NE/D005590/1). Additional funding for fieldwork was provided by Tropical Ecology Assessment and Monitoring (TEAM) Network, a collaboration among Conservation International, the Missouri Botanical Garden, the Smithsonian Institution, and the Wildlife Conservation Society. A.E.M. receives a PhD scholarship from the T-FORCES ERC grant. O.L.P. is supported by an ERC Advanced Grant and a Royal Society Wolfson Research Merit Award. We thank Jon J. Lloyd, Chronis Tzedakis, David Galbraith, and two anonymous reviewers for helpful comments and Dylan Young for helping with the analyses. This study would not be possible without the extensive contributions of numerous field assistants and rural communities in the Neotropical forests. Alfredo Alarcón, Patricia Alvarez Loayza, Plínio Barbosa Camargo, Juan Carlos Licona, Alvaro Cogollo, Massiel Corrales Medina, Jose Daniel Soto, Gloria Gutierrez, Nestor Jaramillo Jarama, Laura Jessica Viscarra, Irina Mendoza Polo, Alexander Parada Gutierrez, Guido Pardo, Lourens Poorter, Adriana Prieto, Freddy Ramirez Arevalo, Agustín Rudas, Rebeca Sibler and Javier Silva Espejo additionally contributed data to this study though their RAINFOR participations. We further thank those colleagues no longer with us, Jean Pierre Veillon, Samuel Almeida, Sandra Patiño and Raimundo Saraiva. Many data come from Alwyn Gentry, whose example has inspired new generations to investigate the diversity of the Neotropics

Group B streptococcus serotype prevalence in reproductive-age women at a tertiary care military medical center relative to global serotype distribution

<p>Abstract</p> <p>Background</p> <p>Group B <it>Streptococcus </it>(GBS) serotype (Ia, Ib, II-IX) correlates with pathogen virulence and clinical prognosis. Epidemiological studies of seroprevalence are an important metric for determining the proportion of serotypes in a given population. The purpose of this study was to evaluate the prevalence of individual GBS serotypes at Madigan Healthcare System (Madigan), the largest military tertiary healthcare facility in the Pacific Northwestern United States, and to compare seroprevalences with international locations.</p> <p>Methods</p> <p>To determine serotype distribution at Madigan, we obtained GBS isolates from standard-of-care anogenital swabs from 207 women of indeterminate gravidity between ages 18-40 during a five month interval. Serotype was determined using a recently described molecular method of polymerase chain reaction by capsular polysaccharide synthesis (cps) genes associated with pathogen virulence.</p> <p>Results</p> <p>Serotypes Ia, III, and V were the most prevalent (28%, 27%, and 17%, respectively). A systematic review of global GBS seroprevalence, meta-analysis, and statistical comparison revealed strikingly similar serodistibution at Madigan relative to civilian-sector populations in Canada and the United States. Serotype Ia was the only serotype consistently higher in North American populations relative to other geographic regions (p < 0.005). The number of non-typeable isolates was significantly lower in the study (p < 0.005).</p> <p>Conclusion</p> <p>This study establishes PCR-based serotyping as a viable strategy for GBS epidemiological surveillance. Our results suggest that GBS seroprevalence remains stable in North America over the past two decades.</p

Ibero-American Consensus on Low- and No-Calorie Sweeteners: Safety, Nutritional Aspects and Benefits in Food and Beverages

International scientific experts in food, nutrition, dietetics, endocrinology, physical activity, paediatrics, nursing, toxicology and public health met in Lisbon on 2-4 July 2017 to develop a Consensus on the use of low- and no-calorie sweeteners (LNCS) as substitutes for sugars and other caloric sweeteners. LNCS are food additives that are broadly used as sugar substitutes to sweeten foods and beverages with the addition of fewer or no calories. They are also used in medicines, health-care products, such as toothpaste, and food supplements. The goal of this Consensus was to provide a useful, evidence-based, point of reference to assist in efforts to reduce free sugars consumption in line with current international public health recommendations. Participating experts in the Lisbon Consensus analysed and evaluated the evidence in relation to the role of LNCS in food safety, their regulation and the nutritional and dietary aspects of their use in foods and beverages. The conclusions of this Consensus were: (1) LNCS are some of the most extensively evaluated dietary constituents, and their safety has been reviewed and confirmed by regulatory bodies globally including the World Health Organisation, the US Food and Drug Administration and the European Food Safety Authority; (2) Consumer education, which is based on the most robust scientific evidence and regulatory processes, on the use of products containing LNCS should be strengthened in a comprehensive and objective way; (3) The use of LNCS in weight reduction programmes that involve replacing caloric sweeteners with LNCS in the context of structured diet plans may favour sustainable weight reduction. Furthermore, their use in diabetes management programmes may contribute to a better glycaemic control in patients, albeit with modest results. LNCS also provide dental health benefits when used in place of free sugars; (4) It is proposed that foods and beverages with LNCS could be included in dietary guidelines as alternative options to products sweetened with free sugars; (5) Continued education of health professionals is required, since they are a key source of information on issues related to food and health for both the general population and patients. With this in mind, the publication of position statements and consensus documents in the academic literature are extremely desirable

Estimating the global conservation status of more than 15,000 Amazonian tree species

Estimates of extinction risk for Amazonian plant and animal species are rare and not often incorporated into land-use policy and conservation planning. We overlay spatial distribution models with historical and projected deforestation to show that at least 36% and up to 57% of all Amazonian tree species are likely to qualify as globally threatened under International Union for Conservation of Nature (IUCN) Red List criteria. If confirmed, these results would increase the number of threatened plant species on Earth by 22%. We show that the trends observed in Amazonia apply to trees throughout the tropics, and we predict thatmost of the world’s >40,000 tropical tree species now qualify as globally threatened. A gap analysis suggests that existing Amazonian protected areas and indigenous territories will protect viable populations of most threatened species if these areas suffer no further degradation, highlighting the key roles that protected areas, indigenous peoples, and improved governance can play in preventing large-scale extinctions in the tropics in this century

TRY plant trait database - enhanced coverage and open access

This article has 730 authors, of which I have only listed the lead author and myself as a representative of University of HelsinkiPlant traits-the morphological, anatomical, physiological, biochemical and phenological characteristics of plants-determine how plants respond to environmental factors, affect other trophic levels, and influence ecosystem properties and their benefits and detriments to people. Plant trait data thus represent the basis for a vast area of research spanning from evolutionary biology, community and functional ecology, to biodiversity conservation, ecosystem and landscape management, restoration, biogeography and earth system modelling. Since its foundation in 2007, the TRY database of plant traits has grown continuously. It now provides unprecedented data coverage under an open access data policy and is the main plant trait database used by the research community worldwide. Increasingly, the TRY database also supports new frontiers of trait-based plant research, including the identification of data gaps and the subsequent mobilization or measurement of new data. To support this development, in this article we evaluate the extent of the trait data compiled in TRY and analyse emerging patterns of data coverage and representativeness. Best species coverage is achieved for categorical traits-almost complete coverage for 'plant growth form'. However, most traits relevant for ecology and vegetation modelling are characterized by continuous intraspecific variation and trait-environmental relationships. These traits have to be measured on individual plants in their respective environment. Despite unprecedented data coverage, we observe a humbling lack of completeness and representativeness of these continuous traits in many aspects. We, therefore, conclude that reducing data gaps and biases in the TRY database remains a key challenge and requires a coordinated approach to data mobilization and trait measurements. This can only be achieved in collaboration with other initiatives.Peer reviewe