Caracterización física de los residuos sólidos de la Facultad Multidisciplinaria Oriental, Universidad de El Salvador, 2012.

El estudio de la caracterización física de los residuos sólidos de la Facultad Multidisciplinaria Oriental (F.M.O), está enmarcado dentro de los Fines de la Universidad de El Salvador que establecen su compromiso en conservar, fomentar y difundir la ciencia, promoviendo la sustentabilidad y la protección de los recursos naturales y el medio ambiente. Así también, el manejo integral de los residuos sólidos se ha vuelto una necesidad para todas las autoridades municipales en el país al entrar en vigencia la Ley del Medio Ambiente que manifiesta la obligación de presentar diagnósticos ambientales de los sitios de disposición final de los residuos sólidos, además, el Reglamento especial de manejo integral de desechos sólidos señala la obligación de contar con sistemas integrales para la gestión de los mismos. La metodología descriptiva, utilizada en la investigación, permitió especificar las propiedades importantes de la caracterización física de residuos sólidos en la F.M.O. Para ello, se incluyeron las variables cualitativas (componentes de los residuos sólidos) y cuantitativas (peso, volumen y densidad); se incluyó la metodología exploratoria, que fue de utilidad porque la temática estudiada no ha sido investigada por otros autores de forma exhaustiva. Los resultados obtenidos según análisis de varianza, muestran que hay diferencia significativa entre al menos uno de los componentes de los residuos sólidos, estableciéndose diferencia significativa entre el plástico con un promedio de 71.98 kgs. y los residuos de comida con un promedio de 81.74 kgs. tienen diferencia significativa con todos los demás componentes de los residuos sólidos de la F.M.O., siendo por tanto planteadas en esta investigación alternativas de tratamiento para los residuos de comida y plástico

Isolation and Identification of Endophytic Fungi from Hypocrea pachybasioides and Investigation of the Fungi Cytotoxic Activities

Background and Objective: In the present study, a wild fungus, Hypocrea pachybasioides, has molecularly identified using ribosomal ITS5-ITS4 region as well as analysis of chemically functional groups. This fungus grows on rotten woods. This study is the first report on chemical and pharmacological activities of the fungus. The Hypocrea genus has been linked to another fungus such as Trichoderma spp., which makes it important to identify this species. There are no studies on the fungus chemical and pharmacological characteristics. The aim of the study was to identify a wild fungus through molecular methods, as well as its chemical and pharmacological identification. Material and Methods: Compounds from methanolic extract of the mycelium and those secreted in the culture broth were assessed. First, fungal deoxyribonucleic acid was extracted for molecular identification. Qualitative assessments were carried out for compounds such as tannins, saponins and coumarins, as well as quantitative assessments for total phenols and flavonoids. High-pressure liquid chromatography analysis was carried out for organic acids. Furthermore, antiproliferative assessments were carried out using sulforhodamine B method. Results and Conclusion: Assessments carried out on both fractions showed that compounds such as alkaloids and saponins included the highest quantities in the suggested hedonic scale. In contrast, anthraquinones were detected in lower quantities, while coumarins and tannins were not detected. Methanolic extract from mycelia showed cytotoxic activity in HeLa cell line. Therefore, Hypocrea pachybasioides can be addressed as a candidate for further pharmacological studies based on the criteria from the National Institutes of Health of the United States. This is suggested as a potentially biotechnological model for identifying various metabolites with therapeutic characteristics. Conflict of interest: The authors declare no conflict of interest.   Introduction   Hypocrea is a genus of fungi belonging to the class of Ascomycetes. Its species are saprophytes and predators of other fungi. There are 509 species belonging to Hypocrea genus, most of them identified by their morphological characteristics. These fungi are widely distributed and grow in tropical, subtropical, moist, arid, temperate and boreal forests. They are brightly or slightly colored and can develop on rotten woods in the form of a shelf. These fungi have been associated with other species of Ascomycota and Basidiomycota of the anamorphic type [1]. Furthermore, Hypocrea (H.) is linked to the anamorphic fungi of Trichoderma spp. since all species have been reported as phylogenetically relatives [1, 2]. All these characteristics make difficulties to identify several species belonging to Hypocrea [2]. Thus, molecular methods are useful tools for the identification of these fungi with phenotypic and genotypic complexities within the species of Hypocrea/ Trichoderma. Molecular identification is important since several species of Hypocrea (anamorph to Trichoderma) have shown activities against pathogenic fungal species such as Phytium spp., Rhizoctonia solani and Verticillium dahliae. Moreover, they can act on Botrytis cinerea, which causes the root rot of forest species, suggesting protective roles to avoid decay in fruit storage [3]. Biological control by Hypocrea spp. was verified in the treatment of pathogenic species such as Fusarium spp. of tomato crops [4]. Similarly, it has been demonstrated that the fungi synthesize chemical compounds that accelerate growth of various vegetable crops. Lo and Lin (2002) [5] reported positive effects on soil using Trichoderma (T.) harzianum for the cultivation of squash and cucumbers while Keswani et al. (2014) reported that Trichoderma spp. secreted several compounds that acted as growth regulators for horseradish, tomato, rice and tobacco [6]. In contrast, studies on compounds secreted by Hypocrea spp. have not been carried out. Since other genera such as Trichoderma are anamorph, it has been suggested that Hypocrea spp. possibly produce various compounds with simple or complex molecular structures and various chemical-biological characteristics. Secondary metabolites such as lignans, flavonoids, phenols, terpenes, sterols, alkaloids, coumarins and antibiotics with various biological characteristics can provide novel uses in various sectors of food, agrochemical and pharmaceutical industries [7]. In the present study, a wild fungus was isolated and identified as H. pachybasioides by molecular approaches. Contents of chemically functional groups such as alkaloids, saponins, anthraquinones, coumarins and tannins were analyzed as well. Moreover, total phenols and flavonoids were assessed in extracts from mycelia and those secreted into the culture broth. The cytotoxic effects of these metabolites were also investigated in three different human tumor cell lines. These data may be useful for further isolations of H. pachybasioides metabolites as potential biotechnological compounds. Materials and Methods 2.1. Fungus collection Fungi used in this study were collected from the Sierra de Tequexquinahuac, Texcoco, Estado de Mexico. Taxo-nomic identification was carried out in the Fungi Laboratory of the Universidad Autonoma Chapingo. 2.2. Culture conditions Collected fungi were disinfected in 1% sodium hypochlorite (v/v) solution for 10 min and then transferred into sterile distilled water (DW) (30 ml) to remove excess sodium hypochlorite. A slice of the fungi was transferred into a Petri dish with potato dextrose agar (PDA) media and incubated at 25 °C for a week (w). After growing the fungi on the plate, a mycelial disk was inoculated into 100 ml of potato dextrose broth (PDB) media and incubated at 25 °C for a week (w). Mycelia were separated from the culture media via filtration and incubated at 35 °C for 3 d. Dehydrated mycelia were pulverized using mortar and then 20 mg of the sample were used for the isolation of DNA. 2.3. DNA extraction Briefly, DNA extraction was carried out using AxyPrep multisource genomic DNA miniprep kit (cat. AP-MN-MS-GDNA-50, Axygen, Union City, CA, USA), based on the manufacturer’s instructions. The DNA integrity was visualized on 0.7% (w/v) agarose gels stained with GelRed (Nucleic Acid Gel, Biotium; Hayward, CA, USA) using MultiDoc-It (UVP; Upland, CA, USA). 2.4. Amplification of the ITS region using PCR The PCR reactions were prepared using the primer pair of ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAA) [9]. The reaction contained 40 ng of genomic DNA, Vent enzyme buffer (1×), MgCl2 (1.5 mM), dNTPs (0.2 mM), primers (each 0.2 μM) and 1.25 U of Vent polymerase enzyme (BioLabs, New England Biolad, Ipswich, MA, USA) in a final volume of 50 µl. Amplification of the genes was carried out using Axigen thermal cycler (Axygen MaxyGene II Thermal Cycler, CA, USA) under the following conditions of one cycle at 94°C for 5 min, 30 cycles at 94°C for 30 s; 5 °C for 45 s and 72°C for 1 min and then one cycle at 72 °C for 5 min. Amplicons were electrophoresed on 2% (w/v) agarose gels. 2.5. Molecular identification of Hypocrea pachybasioides The amplified PCR products of the ITS region were cloned into the vector of pJET1.2/blunt (Thermo Scientific, USA) to achieve a complete sequence of the analyzed and unknown regions. Vectors with the inserts were transformed into competent Escherichia coli Top 10F´ cells (Invitro-genTM, Waltham, MA, USA). Plasmid DNA was extracted using the GeneJET plasmid miniprep kit (Thermo Scientific, Waltham, MA, USA) based on the manufac-turer's instructions. Positive clones were verified through digestion with BglII to release a 550-bp fragment. In addition, clones were sequenced using primers of pJET forward (CGACTCACTATAGGGAGAGCGGC) and pJET Reverse (AAGAACATCGATTTTCCATGGCAG), which was carried out at the Instituto de Biotecnología of the Universidad Autonoma Nacional de Mexico. The sequence was analyzed through sequence comparisons of the GenBank database (NCBI) using Blast algorithm [10].     2.6. Extracellular and intracellular fungal extracts To assess presence of chemically functional compounds e.g. alkaloids, anthraquinones, tannins, volatile coumarins and saponins. Methanol was used to achieve two extracts from the collected fungi, one from the concentrated culture broth (extracellular) and the other one from the mycelia (intracellular). Total phenolics and flavonoids were quanti-fied in the two samples. Moreover, methanol was used to isolate the metabolites. Erlenmeyer flasks with 100 ml of PDB media were inoculated with fungal mycelia and incubated at 25 °C for 10 d. Then, mycelia were separated from the culture media by filtration. Mycelia and filtered broth were dried in an oven at 35 °C for 3 d. Dried mycelia were pulverized using mortar and trans-ferred into 50 ml of methanol for 1 w. Methanolic extract was concentrated under decreased pressure using rotary evaporator. 2.7. Detection of alkaloids and anthraquinones Thin layer chromatography (TLC) was carried out using silica gel plaques with dimensions of 3 × 5 cm (60F254) and results revealed presence of alkaloids and anthraquinones using Dragendorff reagent and UV light, respectively. An aliquot (0.5 μl) of the extract was transferred onto a plate and set in a solvent system of dichloromethane-methanol (95:5). Alkaloids were verified by the appearance of brown-red spots using Dragendorff reagent. Anthraquinones were investigated with the typical yellow or red fluorescent coloring after exposing the plates to UV light [11]. 2.8. Detection of tannins and saponins To analyze tannins in the extracts, three various solutions (10 mL) were prepared, including % (w/v) Tube 1, 1% gelatin solution; Tube 2, 1% gelatin solution and 10% NaCl; and Tube 3, 10% NaCl. Then, 2 ml of the extract were transferred into each tube and vigorously mixed using vortex. White precipitate in Tubes 1 and 2 indicated presence of tannins [11]. To assess saponins in the fungal extract, 2 ml of the samples were transferred into 10 ml of water. Tubes were heated 30 min at 80 °C and then set to cool down at room temperature (RT) and then stirred vigorously. Presence of stable foams within 15–20 min indicated presence of saponins [11]. 2.9. Quantification of total phenols To assess total phenols in the extracts, Folin-Ciocalteu reagent was used based on a protocol by [12]. Results were expressed as mg gallic acid/g dry extract (mgGAE/g) [12]. 2.10. Quantification of total flavonoids The flavonoid content was assessed using standard quercetin following the protocol [12]. Results were reported in mg quercetin/g dry extract (mgQE/g) [12].     2.11. Analysis of organic acids Briefly, D,L-malic, oxalic and tartaric organic acids were detected in the fungal extracts using a methodology developed by [13]. Technically, 20 μl of three various samples were analyzed, including mycelia, filtered broth or the organic acid standards, which were injected into HPLC  of Agilent Technology model 1260 equipped with a quaternary pump (Agilent Technology, California, USA) with a multiple wavelength detector (MWD). The column included an X-Terra MS C18 column, 5 μm (4.6 × 250 mm) and the mobile phase consisted of phosphate buffer (50 mM, pH 2.8) in isocratic mode. The flow was adjusted to 0.7 ml/ min. Results were recorded at 210 nm and used in a standard curve. Results were expressed as parts per million. 2.12. Antiproliferative activity assay To assess cytotoxic effects of H. pachybasioides extracts in human epithelial carcinoma (HeLa). Cell line was incubated at 37 °C in a humidified atmosphere of 5% CO2 and 100% air in complete RPMI 1640 media. Cells in the log growth phase were treated with three various concentrations of methanolic extract from the mycelia in a range of 0.032–20.0 μg/ml and incubated at 37 °C for 72 h under similar culture conditions. Each experiment was carried out in triplicate and colchicine positive control was used as an inhibitor of cell division. Cell concentration was assessed using colorimetric method and sulforhodamine B. Results were expressed as percentage of cell growth using the formula of cellular growth (%) = (At - Ab) / (Ac - Ab) × 100. Where, At was the average OD of the treatment, Ac was the average OD of the control and Ab was the average of the initial growth OD (blank) [14]. 2.13. Statistical analysis Linear regression analysis of the semi-logarithmic graphs between the concentrations and percentages of the cell growth was used. Effective concentration of the compound needed to inhibit cell proliferation by 50% (IC50 in µg/ml) was assessed using Sigma plot software [15]. Results and Discussion 3.1. Fungus molecular identification Molecular identification of the fungi usually uses nuclear DNA markers (18S and 28S ribosomal genes), spacer regions such as ITS 1 and ITS 2, external ETS and IGS intergenic [16]. Although, most of the reports on fungi identification have used the ITS region. Several genomic regions within the ITS region have been standardized and are now referred to as DNA barcodes. These barcodes are short regions, typically 400–800 base pairs (bp) [17], facilitating molecular identification of fungi. This includes anamorphic fungi, which can particularly be challenging to identify [18]. In this study, the ITS4-ITS5 region was used, including ribosomal gene region of 5.8S (Fig. 1A). Fragment was achieved using ITS 4 forward and ITS 5 reverse primers, resulting in an amplicon of 450 bp within the expected range (Fig. 1B) [17]. Gimenez-Pereira et al. reported use of the ITS region to molecularly identify H. pseudokoningii within other filame-ntous fungi [19]. Then, the band obtained was cloned into the pJet 1.2 vector and sequenced using pJet forward and pJet reverse primers. Then, data were analyzed using Gen Bank database of the National Center for Biotechnology Information (NCBI), showing 99% identity and value of 0.0 with the sequence corresponding to H. pachybasioides (GU062213.1). This result helped molecular identification of the collected strain and a phylogenetic tree was construc-ted to show proximity of H. pachybasioides to other strains from similar species, demonstrating its close relationship majorly with other fungi of Trichoderma spp. (Fig. 2). 3.2. Chemically functional groups Compounds such as saponins, tannins, coumarins, alkaloids, anthraquinones in the methanolic extracts from the mycelia and filtered culture media of H. pachybasioides were assessed. All these compounds have been investigated in various organisms because they include pharmacological activities. For example, alkaloids have been used as anticancer, antimicrobial, antiparasitic, antidepressant, anti-malarial, anticonvulsant and antineurodegenerative agents. Anthraquinones are other molecules associated to antiviral, analgesic, diuretic, anticancer, anti-inflammatory, anti-microbial, antiparasitic, vasorelaxant and cathartic activities [20]. Furthermore, tannins may show antitumor, anti-microbial and antioxidant activities [21]. Coumarins have been reported to include anticancer, coagulant, antiedema, anti-hypertensive, anti-hypercholesterolemic, anticoagul-ant, antimicrobial, antiviral and antihypertensive activities [22]. Saponins have shown anticancer, antidiabetic, antiviral, antiallergic, antihypercholestero-lemic, antimicro-bial and antiparasitic activities [23]. Presence of these compounds in the methanolic extracts allowed the current authors to report the first approach on the chemical compounds produced by this fungus. In mycelia, presence of alkaloids was detected at a moderate concentration, while saponins and anthraquinones were detected at lower concentrations. However, the broth extract included a large quantity of saponins and alkaloids (Table 1). Presence of the chemically functional groups highly suggests that some might present a therapeutic activity. Organic acids such as ascorbic, D,L-malic, oxalic and tartaric were enriched in the broth extract, compared to the mycelia, and presented a similar magnification as the juice extracted from Stenocereus stellatus [13] [24]. 3.3. Total phenols and flavonoids quantifications Total phenols and flavonoids were quantified, which might include significant effects on cells [24]. Quantities of total phenols and flavonoids were lower in culture broth, compared to the extract from mycelia, both from a methanolic extract (Table 1). 3.4. Cytotoxic analysis To assess pharmacological activities, cytotoxic assess-ments were carried out using the methanolic extract from the mycelia on cell lines of MCF-7, HeLa and HCT15. So, the half maximal inhibitory concentration (IC50) was calculated by fitting curves of data from the sulforhodamine B assay (Table 1), where the antiproliferative effect was reported. Colchicine was used as control. Results showed that HeLa was the most sensitive cell line to the extract with an IC50 of 12.9 ppm while no activity was detec-ted in MCF-7 and HCT15 cells, less than 20 ppm in the assessed range. The IC50 was established as a criterion for cytotoxic activity of the crude extracts by the US national cancer institute; in which, range of 0-20 ppm is cytotoxic [25]. 3.5. Relationships between the chemical compounds and cytotoxic assay Use of fungi for the extraction of various compounds of nutritional and medicinal importance has extensively been studied. Although fungi are primary microorganisms producing metabolites, a few studies have focused on the analysis of chemically functional groups in the fungi. Compounds with pharmacological activity have already been identified and characterized. Saponins are used as compounds with antifungal activity such as strobilurins and oudesmansins present in basidiomycetes and ascomycetes. Endophytic fungi of medicinal plants such as Nectria, Aspergillus, Fusarium, Verticillium, Engyodontium, Plectosphaerella, Penicillium and Cladospori include these compounds, showing antifungal and antibacterial activities. Furthermore, these fungi are industrial materials to produce saponins with antimicrobial activity for use in health and agricultural sectors [26], It is noteworthy that these treatments are mostly used as mixtures. It is possible to improve effects of nano transporters [27]. It is well known that phenolics include antioxidant capacity. In this study, total phenolic compounds and flavonoids were assessed and the quantity was higher in mycelia than broth. In plants, most of the phenolics are in detected in the cytosol. This explains differences between the mycelia and broth extracts since the mycelial extract suffers cell disruption. It is useful to carry out studies on the antioxidant capacity of H. pachybasioides, as reported by Zeng et al., 2011 in two Hypocrea spp. [28]. Alkaloids include pharmacological activities such as antimicrobial, insecticidal, cytotoxic, vasoconstrictive, anti-hemorrhagic and anticancer activities. For example, ergometrine and ergoline from Claviceps spp. have shown vasoconstricting and anti-hemorrhagic activities and are used for migraine treatment. Oxalin extracted from P. oxalicum is an alkaloid with strong cytotoxic activity similar to taxol that is reported to arrest the cell cycle in M phase [29]. Reports of anthraquinones with pharmacological effects on fungi are little; however, tetrahydro-anthraquinone of Alternaria sp. XZSBG-1 has shown cytotoxic activity on cell lines of HCT-16 and HeLa while 6-8-di-O-methylveranthine isolated from A. versicolor EN-7 has shown antibacterial effects on E. coli and Staphylococcus aureus. Furthermore, T. aureoviride PSU-F95 produces two anthraquinones: coniotrantra-quinone-1 and emodine, which inhibit the growth of resistant strains of S. aureus [30]. These studies support results of the current study because with the extract from the mycelia, it was possible to report important cytotoxic activities for HeLa cell lines. Further studies are recommended to isolate specific metabolites in H. pachybasioides. Compounds with higher cytotoxic activities isolated from fungi are polysaccharides and heteropolysaccharides, which include high solubility in water and alcohols. These present better results when assessed with in vitro models on cancer cell lines [31]. The current results are aligned with this idea because it has been observed that methanolic extract of the H. pachybasioides mycelia includes antiproliferative activity for HeLa cell line. Trichoderma spp. produce such effects in Hela and HCT-7 cell lines [32]. Another important example is lipopeptaibols isolated from T. strigosum that have shown activity against various cell lines, including HCT-116 [33]. Cytotoxic activity of H. pachybasioides mycelia might be associated to high phenol contents, as occurs in S. stellatus extracts previously achieved in the current authors’ laboratory. It is suggested that phenols enhance antioxidant activity in cells. Correlations have been made between the cytotoxic effects and total phenols, antioxidant activities and cytotoxicity using the following formula: “Antioxidant capacity = a * phenols + b * D_malic + c * glucose; where, a = 0.54, b = 0.56, c = 0.28 (standard errors = 0.19, 0.20 and 0.21, respectively) and R = 0.76” [22]. This correlation with data was achieved from peels of tropical fruits: Annona squamosa L. (purple sugar apple), A. reticulata L. (custard apple), Chrysophyllum cainito L. (green star apple) and Melicoccus bijugatus Jacq. (mamoncillo) with a correlation with r2 = 0.97 (p = 0.05) with total phenols [24,34]. Conclusion In this study, a wild fungus was identified as H. pachybasioides using molecular approaches. A general study was carried out to assess various metabolites. It has been shown that methanolic extract from the myce

Estilos de Crianza y Problemas de Conducta Externalizados en Preescolar

The main objective of this study was to describe and analyze the correlation between parental parenting styles and externalized behavioral problems of children of the "Tierra y Libertad" preschool, Juan José Ríos, Guasave, Sinaloa; in a sample of 16 parents, through the questionnaires of Parenting Practices of Daring and Dimensions (PSDQ) and Inventory Eyberg of behavior in children (ECBI). We used a research methodology with a quantitative approach, non-experimental design, transectional type and descriptive-correlational scope. Concluding through the Pearson correlation analysis that there is an association between the variables and the need to implement training programs for parents arisesEl presente estudio tuvo como objetivo general, describir y analizar la correlación entre los estilos de crianza de los padres y los problemas de conducta externalizados de los niños de preescolar “Tierra y Libertad”, Juan José Ríos, Guasave, Sinaloa; en una muestra de 16 padres, mediante los cuestionarios de Prácticas Parentales de Crianza y Dimensiones (PSDQ) e Inventario Eyberg de comportamiento en niños (ECBI). Se utilizó una metodología de investigación con enfoque cuantitativo, diseño no experimental, tipo transeccional y de alcance descriptivocorrelacional. Concluyendo a través del análisis de correlación de Pearson que si existe asociación entre las variables y surgiendo la necesidad de implementar programas de entrenamiento a padres

Single nucleotide variations in ZBTB46 are associated with post-thrombolytic parenchymal haematoma

Haemorrhagic transformation is a complication of recombinant tissue-plasminogen activator treatment. The most severe form, parenchymal haematoma, can result in neurological deterioration, disability, and death. Our objective was to identify single nucleotide variations associated with a risk of parenchymal haematoma following thrombolytic therapy in patients with acute ischaemic stroke. A fixed-effect genome-wide meta-analysis was performed combining two-stage genome-wide association studies (n = 1904). The discovery stage (three cohorts) comprised 1324 ischaemic stroke individuals, 5.4% of whom had a parenchymal haematoma. Genetic variants yielding a P-value < 0.05 1 x 10(-5) were analysed in the validation stage (six cohorts), formed by 580 ischaemic stroke patients with 12.1% haemorrhagic events. All participants received recombinant tissue-plasminogen activator; cases were parenchymal haematoma type 1 or 2 as defined by the European Cooperative Acute Stroke Study (ECASS) criteria. Genome-wide significant findings (P < 5 x 10(-8)) were characterized by in silica functional annotation, gene expression, and DNA regulatory elements. We analysed 7 989 272 single nucleotide polymorphisms and identified a genome-wide association locus on chromosome 20 in the discovery cohort; functional annotation indicated that the ZBTB46 gene was driving the association for chromosome 20. The top single nucleotide polymorphism was rs76484331 in the ZBTB46 gene [P = 2.49 x 10(-8); odds ratio (OR): 11.21; 95% confidence interval (CI): 4.82-26.55]. In the replication cohort (n = 580), the rs76484331 polymorphism was associated with parenchymal haematoma (P = 0.01), and the overall association after meta-analysis increased (P = 1.61 x 10(-8), OR: 5.84; 95% CI: 3.16-10.76). ZBTB46 codes the zinc finger and BTB domain-containing protein 46 that acts as a transcription factor. In silica studies indicated that ZBTB46 is expressed in brain tissue by neurons and endothelial cells. Moreover, rs76484331 interacts with the promoter sites located at 20q13. In conclusion, we identified single nucleotide variants in the ZBTB46 gene associated with a higher risk of parenchymal haematoma following recombinant tissue-plasminogen activator treatment.Peer reviewe

Forward-central two-particle correlations in p-Pb collisions at root s(NN)=5.02 TeV

Two-particle angular correlations between trigger particles in the forward pseudorapidity range (2.5 2GeV/c. (C) 2015 CERN for the benefit of the ALICE Collaboration. Published by Elsevier B. V.Peer reviewe

Event-shape engineering for inclusive spectra and elliptic flow in Pb-Pb collisions at root(NN)-N-S=2.76 TeV

Peer reviewe

Azimuthal anisotropy of charged jet production in root s(NN)=2.76 TeV Pb-Pb collisions

We present measurements of the azimuthal dependence of charged jet production in central and semi-central root s(NN) = 2.76 TeV Pb-Pb collisions with respect to the second harmonic event plane, quantified as nu(ch)(2) (jet). Jet finding is performed employing the anti-k(T) algorithm with a resolution parameter R = 0.2 using charged tracks from the ALICE tracking system. The contribution of the azimuthal anisotropy of the underlying event is taken into account event-by-event. The remaining (statistical) region-to-region fluctuations are removed on an ensemble basis by unfolding the jet spectra for different event plane orientations independently. Significant non-zero nu(ch)(2) (jet) is observed in semi-central collisions (30-50% centrality) for 20 <p(T)(ch) (jet) <90 GeV/c. The azimuthal dependence of the charged jet production is similar to the dependence observed for jets comprising both charged and neutral fragments, and compatible with measurements of the nu(2) of single charged particles at high p(T). Good agreement between the data and predictions from JEWEL, an event generator simulating parton shower evolution in the presence of a dense QCD medium, is found in semi-central collisions. (C) 2015 CERN for the benefit of the ALICE Collaboration. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).Peer reviewe

Canagliflozin and renal outcomes in type 2 diabetes and nephropathy

BACKGROUND Type 2 diabetes mellitus is the leading cause of kidney failure worldwide, but few effective long-term treatments are available. In cardiovascular trials of inhibitors of sodium–glucose cotransporter 2 (SGLT2), exploratory results have suggested that such drugs may improve renal outcomes in patients with type 2 diabetes. METHODS In this double-blind, randomized trial, we assigned patients with type 2 diabetes and albuminuric chronic kidney disease to receive canagliflozin, an oral SGLT2 inhibitor, at a dose of 100 mg daily or placebo. All the patients had an estimated glomerular filtration rate (GFR) of 30 to &lt;90 ml per minute per 1.73 m2 of body-surface area and albuminuria (ratio of albumin [mg] to creatinine [g], &gt;300 to 5000) and were treated with renin–angiotensin system blockade. The primary outcome was a composite of end-stage kidney disease (dialysis, transplantation, or a sustained estimated GFR of &lt;15 ml per minute per 1.73 m2), a doubling of the serum creatinine level, or death from renal or cardiovascular causes. Prespecified secondary outcomes were tested hierarchically. RESULTS The trial was stopped early after a planned interim analysis on the recommendation of the data and safety monitoring committee. At that time, 4401 patients had undergone randomization, with a median follow-up of 2.62 years. The relative risk of the primary outcome was 30% lower in the canagliflozin group than in the placebo group, with event rates of 43.2 and 61.2 per 1000 patient-years, respectively (hazard ratio, 0.70; 95% confidence interval [CI], 0.59 to 0.82; P=0.00001). The relative risk of the renal-specific composite of end-stage kidney disease, a doubling of the creatinine level, or death from renal causes was lower by 34% (hazard ratio, 0.66; 95% CI, 0.53 to 0.81; P&lt;0.001), and the relative risk of end-stage kidney disease was lower by 32% (hazard ratio, 0.68; 95% CI, 0.54 to 0.86; P=0.002). The canagliflozin group also had a lower risk of cardiovascular death, myocardial infarction, or stroke (hazard ratio, 0.80; 95% CI, 0.67 to 0.95; P=0.01) and hospitalization for heart failure (hazard ratio, 0.61; 95% CI, 0.47 to 0.80; P&lt;0.001). There were no significant differences in rates of amputation or fracture. CONCLUSIONS In patients with type 2 diabetes and kidney disease, the risk of kidney failure and cardiovascular events was lower in the canagliflozin group than in the placebo group at a median follow-up of 2.62 years