1,757 research outputs found
Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli
Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer
Rates of rat liver RNA degradation in vivo as determined from cytidine release during brief cyclic perfusion in situ
A physiological time analysis of the duration of the gonotrophic cycle of Anopheles pseudopunctipennis and its implications for malaria transmission in Bolivia
<p>Abstract</p> <p>Background</p> <p>The length of the gonotrophic cycle varies the vectorial capacity of a mosquito vector and therefore its exact estimation is important in epidemiological modelling. Because the gonotrophic cycle length depends on temperature, its estimation can be satisfactorily computed by means of physiological time analysis.</p> <p>Methods</p> <p>A model of physiological time was developed and calibrated for <it>Anopheles pseudopunctipennis</it>, one of the main malaria vectors in South America, using data from laboratory temperature controlled experiments. The model was validated under varying temperatures and could predict the time elapsed from blood engorgement to oviposition according to the temperature.</p> <p>Results</p> <p>In laboratory experiments, a batch of <it>An. pseudopunctipennis </it>fed at the same time may lay eggs during several consecutive nights (2–3 at high temperature and > 10 at low temperature). The model took into account such pattern and was used to predict the range of the gonotrophic cycle duration of <it>An. pseudopunctipennis </it>in four characteristic sites of Bolivia. It showed that the predicted cycle duration for <it>An. pseudopunctipennis </it>exhibited a seasonal pattern, with higher variances where climatic conditions were less stable. Predicted mean values of the (minimum) duration ranged from 3.3 days up to > 10 days, depending on the season and the geographical location. The analysis of ovaries development stages of field collected biting mosquitoes indicated that the phase 1 of Beklemishev might be of significant duration for <it>An. pseudopunctipennis</it>. The gonotrophic cycle length of <it>An. pseudopunctipennis </it>correlates with malaria transmission patterns observed in Bolivia which depend on locations and seasons.</p> <p>Conclusion</p> <p>A new presentation of cycle length results taking into account the number of ovipositing nights and the proportion of mosquitoes laying eggs is suggested. The present approach using physiological time analysis might serve as an outline to other similar studies and allows the inclusion of temperature effects on the gonotrophic cycle in transmission models. However, to better explore the effects of temperature on malaria transmission, the others parameters of the vectorial capacity should be included in the analysis and modelled accordingly.</p
Excited States of Proton-bound DNA/RNA Base Homo-dimers: Pyrimidines
We are presenting the electronic photo fragment spectra of the protonated
pyrimidine DNA bases homo-dimers. Only the thymine dimer exhibits a well
structured vibrational progression, while protonated monomer shows broad
vibrational bands. This shows that proton bonding can block some non radiative
processes present in the monomer.Comment: We acknowledge the use of the computing facility cluster GMPCS of the
LUMAT federation (FR LUMAT 2764
Population genetic structure of Aedes polynesiensis in the Society Islands of French Polynesia: implications for control using a Wolbachia-based autocidal strategy
Abstract Background Aedes polynesiensis is the primary vector of Wuchereria bancrofti in the South Pacific and an important vector of dengue virus. An improved understanding of the mosquito population genetics is needed for insight into the population dynamics and dispersal, which can aid in understanding the epidemiology of disease transmission and control of the vector. In light of the potential release of a Wolbachia infected strain for vector control, our objectives were to investigate the microgeographical and temporal population genetic structure of A. polynesiensis within the Society Islands of French Polynesia, and to compare the genetic background of a laboratory strain intended for release into its population of origin. Methods A panel of eight microsatellite loci were used to genotype A. polynesiensis samples collected in French Polynesia from 2005-2008 and introgressed A. polynesiensis and Aedes riversi laboratory strains. Examination of genetic differentiation was performed using F-statistics, STRUCTURE, and an AMOVA. BAYESASS was used to estimate direction and rates of mosquito movement. Results FST values, AMOVA, and STRUCTURE analyses suggest low levels of intra-island differentiation from multiple collection sites on Tahiti, Raiatea, and Maupiti. Significant pair-wise FST values translate to relatively minor levels of inter-island genetic differentiation between more isolated islands and little differentiation between islands with greater commercial traffic (i.e., Tahiti, Raiatea, and Moorea). STRUCTURE analyses also indicate two population groups across the Society Islands, and the genetic makeup of Wolbachia infected strains intended for release is similar to that of wild-type populations from its island of origin, and unlike that of A. riversi. Conclusions The observed panmictic population on Tahiti, Raiatea, and Moorea is consistent with hypothesized gene flow occurring between islands that have relatively high levels of air and maritime traffic, compared to that of the more isolated Maupiti and Tahaa. Gene flow and potential mosquito movement is discussed in relation to trials of applied autocidal strategies.</p
Multiplicity dependence of jet-like two-particle correlations in p-Pb collisions at = 5.02 TeV
Two-particle angular correlations between unidentified charged trigger and
associated particles are measured by the ALICE detector in p-Pb collisions at a
nucleon-nucleon centre-of-mass energy of 5.02 TeV. The transverse-momentum
range 0.7 5.0 GeV/ is examined,
to include correlations induced by jets originating from low
momen\-tum-transfer scatterings (minijets). The correlations expressed as
associated yield per trigger particle are obtained in the pseudorapidity range
. The near-side long-range pseudorapidity correlations observed in
high-multiplicity p-Pb collisions are subtracted from both near-side
short-range and away-side correlations in order to remove the non-jet-like
components. The yields in the jet-like peaks are found to be invariant with
event multiplicity with the exception of events with low multiplicity. This
invariance is consistent with the particles being produced via the incoherent
fragmentation of multiple parton--parton scatterings, while the yield related
to the previously observed ridge structures is not jet-related. The number of
uncorrelated sources of particle production is found to increase linearly with
multiplicity, suggesting no saturation of the number of multi-parton
interactions even in the highest multiplicity p-Pb collisions. Further, the
number scales in the intermediate multiplicity region with the number of binary
nucleon-nucleon collisions estimated with a Glauber Monte-Carlo simulation.Comment: 23 pages, 6 captioned figures, 1 table, authors from page 17,
published version, figures at
http://aliceinfo.cern.ch/ArtSubmission/node/161
Charge separation relative to the reaction plane in Pb-Pb collisions at TeV
Measurements of charge dependent azimuthal correlations with the ALICE
detector at the LHC are reported for Pb-Pb collisions at TeV. Two- and three-particle charge-dependent azimuthal correlations in
the pseudo-rapidity range are presented as a function of the
collision centrality, particle separation in pseudo-rapidity, and transverse
momentum. A clear signal compatible with a charge-dependent separation relative
to the reaction plane is observed, which shows little or no collision energy
dependence when compared to measurements at RHIC energies. This provides a new
insight for understanding the nature of the charge dependent azimuthal
correlations observed at RHIC and LHC energies.Comment: 12 pages, 3 captioned figures, authors from page 2 to 6, published
version, figures at http://aliceinfo.cern.ch/ArtSubmission/node/286
Multi-particle azimuthal correlations in p-Pb and Pb-Pb collisions at the CERN Large Hadron Collider
Measurements of multi-particle azimuthal correlations (cumulants) for charged
particles in p-Pb and Pb-Pb collisions are presented. They help address the
question of whether there is evidence for global, flow-like, azimuthal
correlations in the p-Pb system. Comparisons are made to measurements from the
larger Pb-Pb system, where such evidence is established. In particular, the
second harmonic two-particle cumulants are found to decrease with multiplicity,
characteristic of a dominance of few-particle correlations in p-Pb collisions.
However, when a gap is placed to suppress such correlations,
the two-particle cumulants begin to rise at high-multiplicity, indicating the
presence of global azimuthal correlations. The Pb-Pb values are higher than the
p-Pb values at similar multiplicities. In both systems, the second harmonic
four-particle cumulants exhibit a transition from positive to negative values
when the multiplicity increases. The negative values allow for a measurement of
to be made, which is found to be higher in Pb-Pb collisions at
similar multiplicities. The second harmonic six-particle cumulants are also
found to be higher in Pb-Pb collisions. In Pb-Pb collisions, we generally find
which is indicative of a Bessel-Gaussian
function for the distribution. For very high-multiplicity Pb-Pb
collisions, we observe that the four- and six-particle cumulants become
consistent with 0. Finally, third harmonic two-particle cumulants in p-Pb and
Pb-Pb are measured. These are found to be similar for overlapping
multiplicities, when a gap is placed.Comment: 25 pages, 11 captioned figures, 3 tables, authors from page 20,
published version, figures at http://aliceinfo.cern.ch/ArtSubmission/node/87
A note on comonotonicity and positivity of the control components of decoupled quadratic FBSDE
In this small note we are concerned with the solution of Forward-Backward
Stochastic Differential Equations (FBSDE) with drivers that grow quadratically
in the control component (quadratic growth FBSDE or qgFBSDE). The main theorem
is a comparison result that allows comparing componentwise the signs of the
control processes of two different qgFBSDE. As a byproduct one obtains
conditions that allow establishing the positivity of the control process.Comment: accepted for publicatio
Transverse sphericity of primary charged particles in minimum bias proton-proton collisions at , 2.76 and 7 TeV
Measurements of the sphericity of primary charged particles in minimum bias
proton--proton collisions at , 2.76 and 7 TeV with the ALICE
detector at the LHC are presented. The observable is linearized to be collinear
safe and is measured in the plane perpendicular to the beam direction using
primary charged tracks with GeV/c in . The
mean sphericity as a function of the charged particle multiplicity at
mid-rapidity () is reported for events with different
scales ("soft" and "hard") defined by the transverse momentum of the leading
particle. In addition, the mean charged particle transverse momentum versus
multiplicity is presented for the different event classes, and the sphericity
distributions in bins of multiplicity are presented. The data are compared with
calculations of standard Monte Carlo event generators. The transverse
sphericity is found to grow with multiplicity at all collision energies, with a
steeper rise at low , whereas the event generators show the
opposite tendency. The combined study of the sphericity and the mean with multiplicity indicates that most of the tested event generators
produce events with higher multiplicity by generating more back-to-back jets
resulting in decreased sphericity (and isotropy). The PYTHIA6 generator with
tune PERUGIA-2011 exhibits a noticeable improvement in describing the data,
compared to the other tested generators.Comment: 21 pages, 9 captioned figures, 3 tables, authors from page 16,
published version, figures from
http://aliceinfo.cern.ch/ArtSubmission/node/308
- …