First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia

Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia. Samples of wild grapevines were labeled during the vegetative season and dormant canes from 84 accessions (male and female plants) were collected during winter. All samples were tested by RT-PCR for the presence of GRSPaV using primers RSP-48 (5'- AGCTGGGATTATAAGGGAGGT-3') and RSP-49 (5'- CCAGCCGTTCCACCACTAAT-3') (Lima et al. 2006a) for the amplification of a 331 bp fragment of the coat protein (CP) gene. Results showed that 51% (43/84) of the samples were infected by GRSPaV. In order to confirm the presence of this virus in wild grapevines, two positive samples (VS56 and VS70) were tested by RT-PCR using primers RSP-52 (5'-TGAAGGCTTTAGGGGTTAG-3') and RSP-53 (5'-CTTAACCCAGCCTTGAAAT-3') (Rowhani et al. 2000) to amplify the complete CP. Isolate VS56 was from a male plant in northern Tunisia and isolate VS70 was from a female plant in the northeast of the country. PCR products of these two isolates were cloned and sequenced in both directions. The Tunisian GRSPaV isolates VS56 (LT855232) and VS70 (LT855235) shared 84% nucleotide sequence identity. Isolate VS56 had 85-86% identity with all GRSPaV sequences available in GenBank, whereas VS70 showed 93-99% identities with isolates SK704-A (KX274274) and ORPN12 (FJ943318). To further confirm the presence of GRSPaV in wild grapevines, the same two samples were tested by RT-PCR using primers McK1U (AGGGATTGGCTGTTAGATGTT) and McK1D (CTTCAGGCAACCCCAAAAA) (Nolasco et al. 2000) to amplify a 355 bp fragment of the RNA-dependent RNA polymerase domain. Isolates VS56 (LT906626) and VS70 (LT906636) shared 89% nucleotide sequence identity. Isolate VS56 had 89-94% identity with isolates SK30 (KX274277) and GRSPaV-MG (FR691076) while VS70 showed 94-95% identity with isolates Tannat-Rspav1 (KR528585) and GRSPaV-GG (JQ922417). To our knowledge, this is the first report of GRSPaV in wild grapevines in Tunisia

Effects of forcing differences and initial conditions on inter-model agreement in the VolMIP volc-pinatubo-full experiment

International audienceThis paper provides initial results from a multi-model ensemble analysis based on the volc-pinatubo-full experiment performed within the Model Intercomparison Project on the climatic response to volcanic forcing (VolMIP) as part of the sixth phase of the Coupled Model Intercomparison Project (CMIP6). The volc-pinatubo-full experiment is based on ensemble of volcanic forcing-only climate simulations with the same volcanic aerosol dataset across the participating models (the 1991-1993 Pinatubo period from the CMIP6-GloSSAC dataset). The simulations are conducted within an idealized experimental design where initial states are sampled consistently across models from the CMIP6-piControl simulation providing unperturbed pre-industrial background conditions. The multi-model ensemble includes output from an initial set of six participating Earth system models (CanESM5, GISS-E2.1-G, IPSL-CM6A-LR, MIROC-E2SL, MPI-ESM1.2-LR and UKESM1).The results show overall good agreement between the different models on the global and hemispheric scale concerning the surface climate responses, thus demonstrating the overall effectiveness of VolMIP’s experimental design. However, small yet significant inter-model discrepancies are found in radiative fluxes especially in the tropics, that preliminary analyses link with minor differences in forcing implementation, model physics, notably aerosol-radiation interactions, the simulation and sampling of El Niño-Southern Oscillation (ENSO) and, possibly, the simulation of climate feedbacks operating in the tropics. We discuss the volc-pinatubo-full protocol and highlight the advantages of volcanic forcing experiments defined within a carefully designed protocol with respect to emerging modeling approaches based on large ensemble transient simulations. We identify how the VolMIP strategy could be improved in future phases of the initiative to ensure a cleaner sampling protocolwith greater focus on the evolving state of ENSO in the pre-eruption period

Improved functionalization of oleic acid-coated iron oxide nanoparticles for biomedical applications

Superparamagnetic iron oxide nanoparticles can providemultiple benefits for biomedical applications in aqueous environments such asmagnetic separation or magnetic resonance imaging. To increase the colloidal stability and allow subsequent reactions, the introduction of hydrophilic functional groups onto the particles’ surface is essential. During this process, the original coating is exchanged by preferably covalently bonded ligands such as trialkoxysilanes. The duration of the silane exchange reaction, which commonly takes more than 24 h, is an important drawback for this approach. In this paper, we present a novel method, which introduces ultrasonication as an energy source to dramatically accelerate this process, resulting in high-quality waterdispersible nanoparticles around 10 nmin size. To prove the generic character, different functional groups were introduced on the surface including polyethylene glycol chains, carboxylic acid, amine, and thiol groups. Their colloidal stability in various aqueous buffer solutions as well as human plasma and serum was investigated to allow implementation in biomedical and sensing applications.status: publishe

The challenges and opportunities of addressing particle size effects in sediment source fingerprinting: A review

publisher: Elsevier articletitle: The challenges and opportunities of addressing particle size effects in sediment source fingerprinting: A review journaltitle: Earth-Science Reviews articlelink: http://dx.doi.org/10.1016/j.earscirev.2017.04.009 content_type: article copyright: © 2017 Elsevier B.V. All rights reserved

Traitement morphologique de signaux unidimensionnels

Cette communication présente les premiers résultats des travaux relatifs à une nouvelle approche de traitement de signal unidimensionnel basée sur les techniques de la morphologie mathématique qui sont utilisées en traitement d'images. Après avoir défini les opérations morphologiques de base sur les signaux temporels et présenté leur application à la détection du fondamental du signal de parole. Nous présentons une série de transformations morphologiques dites adaptatives et particulièrement la transformation par les extrema. Nous introduisons pour terminer, la notion de filtrage morphologique des signaux temporels en donnant des exemples d'application liés au lissage des signaux bruités, à la détection de formes d'ondes particulières pour l'estimation de la puissance instantannée du signal de parole

Attitude et comportement des opérateurs à l’égard des risques à l’export : cas des exportations des dattes tunisiennes

International audienceThe process of market liberalization makes the Tunisian exports of agricultural products face a high competition. Therefore, exploring new market opportunities through the expansion of the traditional markets and the penetration of new ones become necessary. However, such an approach may entail some risks for exporters, especially in the dates sector. The present study aims at analyzing the attitudes of the operators against export risks, especially credit risk, and how they manage them. It is shown that the export activity is strongly based on traditional markets, with little effort of finding new market niches. Through a hierarchical cluster analysis, three classes of exporter’s profiles have been identified, revealing a different risk perception among exporters in addition to the use of payment instruments with no guarantees to exporters and low adhesion to export credit insurance system.Le processus d’ouverture des marchés et de libéralisation ne cesse de soumettre les exportations tunisiennes des produits agricoles à une forte concurrence, d’où la nécessité de prospecter de nouvelles opportunités commerciales à travers l’extension des marchés traditionnels et la conquête de nouvelles destinations. Néanmoins, une telle démarche n’est pas exempte de risques pour les opérateurs, en particulier dans le secteur dattier, un secteur remarquable et en évolution sur le plan export. Le présent travail se propose d’analyser les attitudes des opérateurs à l’égard des risques à l’export, particulièrement le risque de crédit, et leur manière de les gérer. L’analyse menée a permis de révéler que l’activité export est basée en grande partie sur des marchés traditionnels, avec peu d’effort de recherche de nouvelles niches. Moyennant une analyse de classification hiérarchique, trois classes de profils d’opérateurs ont été identifiées, révélant une différente perception entre les opérateurs ainsi qu’une utilisation d’instruments de paiement ne présentant pas de garantie aux exportateurs et une faible adhésion au système d’assurance crédit à l’export