82 research outputs found
Serum Homocysteine Levels and its Methylenetetrahydrofolate Gene (MTHFR) C677t Polymorphism in Patients with Hemodialysis
Homocysteine plays an important role in cardiovascular disease as an independent risk factor, especially in patients with renal insufficiency. The present study aimed to determine whether Hcy levels, or those of its C677T polymorphism, were associated with higher mortality in patients submitted to chronic hemodialysis treatment. This was a descriptive, prospective study. Chronic renal patients undergoing hemodialysis in the "General Hospital, ISSSTE" Dr. Darío Fernández Fierro, Mexico City were included in the study. Serum homocysteine was analyzed by means of an ELISA test. The primers utilized for MTHFR C677T polymorphism identification were the following: F: 5'TGAAGGAGAAGGTGTCTGCGGGA3', R: 5'AGGACGGTGCGGTGAGTG3' and F2: 5’GCAGGGAGCTTTGAGGCTGAC3’. Differences among nominal conditions were evaluated by the Mann-Whitney U-test. Spearman test was used for correlation among variables. Regression, log-linear analysis and receiver operating characteristic (ROC) curves were conducted to evaluate the possible influence on prognosis of Hcy levels and the presence of the MTHFR C677T polymorphism. Cox regression and Kaplan-Meier tests were performed to evaluate the Hcy levels influence on survival. In all cases, p<0.05 was considered statistically significant. All tests were performed with the SPSS ver. 23 statistical software program. By means of regression analysis (p = 0.046) and ROC curve age was the sole significant prognostic variable for the "death". The loglinear analysis did not show any association between the presence of MTHFR C677T SNP with the mortality of patients. It was concluded that Hcy levels and the presence/absence of MTHFR C677T are not stronger predictors for mortality than the traditional cardiovascular risk factors."Dr. Darío Fernández Fierro" General Hospital. Ciprés Grupo Médico S.C. (CGM)
Posture as Index for Approach-Avoidance Behavior
Approach and avoidance are two behavioral responses that make people tend to approach positive and avoid negative situations. This study examines whether postural behavior is influenced by the affective state of pictures. While standing on the Wii™ Balance Board, participants viewed pleasant, neutral, and unpleasant pictures (passively viewing phase). Then they had to move their body to the left or the right (lateral movement phase) to make the next picture appear. We recorded movements in the anterior-posterior direction to examine approach and avoidant behavior. During passively viewing, people approached pleasant pictures. They avoided unpleasant ones while they made a lateral movement. These findings provide support for the idea that we tend to approach positive and avoid negative situations
Language Comprehension in the Balance: The Robustness of the Action-Compatibility Effect (ACE)
How does language comprehension interact with motor activity? We investigated the conditions under which comprehending an action sentence affects people's balance. We performed two experiments to assess whether sentences describing forward or backward movement modulate the lateral movements made by subjects who made sensibility judgments about the sentences. In one experiment subjects were standing on a balance board and in the other they were seated on a balance board that was mounted on a chair. This allowed us to investigate whether the action compatibility effect (ACE) is robust and persists in the face of salient incompatibilities between sentence content and subject movement. Growth-curve analysis of the movement trajectories produced by the subjects in response to the sentences suggests that the ACE is indeed robust. Sentence content influenced movement trajectory despite salient inconsistencies between implied and actual movement. These results are interpreted in the context of the current discussion of embodied, or grounded, language comprehension and meaning representation
Current commands for high-efficiency torque control of DC shunt motor
The current commands for a high-efficiency torque control of a DC shunt motor are described. In the proposed control method, the effect of a magnetic saturation and an armature reaction are taken into account by representing the coefficients of an electromotive force and a torque as a function of the field current, the armature current and the revolving speed. The current commands at which the loss of the motor drive system becomes a minimum are calculated as an optimal problem. The proposed control technique of a motor is implemented on the microprocessor-based control system. The effect of the consideration of the magnetic saturation and the armature reaction on the produced torque and the minimisation of the loss are discussed analytically and experimentally </p
Human subcortical brain asymmetries in 15,847 people worldwide reveal effects of age and sex
The two hemispheres of the human brain differ functionally and structurally. Despite over a century of research, the extent to which brain asymmetry is influenced by sex, handedness, age, and genetic factors is still controversial. Here we present the largest ever analysis of subcortical brain asymmetries, in a harmonized multi-site study using meta-analysis methods. Volumetric asymmetry of seven subcortical structures was assessed in 15,847 MRI scans from 52 datasets worldwide. There were sex differences in the asymmetry of the globus pallidus and putamen. Heritability estimates, derived from 1170 subjects belonging to 71 extended pedigrees, revealed that additive genetic factors influenced the asymmetry of these two structures and that of the hippocampus and thalamus. Handedness had no detectable effect on subcortical asymmetries, even in this unprecedented sample size, but the asymmetry of the putamen varied with age. Genetic drivers of asymmetry in the hippocampus, thalamus and basal ganglia may affect variability in human cognition, including susceptibility to psychiatric disorders
Reproducibility in the absence of selective reporting : An illustration from large-scale brain asymmetry research
Altres ajuts: Max Planck Society (Germany).The problem of poor reproducibility of scientific findings has received much attention over recent years, in a variety of fields including psychology and neuroscience. The problem has been partly attributed to publication bias and unwanted practices such as p-hacking. Low statistical power in individual studies is also understood to be an important factor. In a recent multisite collaborative study, we mapped brain anatomical left-right asymmetries for regional measures of surface area and cortical thickness, in 99 MRI datasets from around the world, for a total of over 17,000 participants. In the present study, we revisited these hemispheric effects from the perspective of reproducibility. Within each dataset, we considered that an effect had been reproduced when it matched the meta-analytic effect from the 98 other datasets, in terms of effect direction and significance threshold. In this sense, the results within each dataset were viewed as coming from separate studies in an "ideal publishing environment," that is, free from selective reporting and p hacking. We found an average reproducibility rate of 63.2% (SD = 22.9%, min = 22.2%, max = 97.0%). As expected, reproducibility was higher for larger effects and in larger datasets. Reproducibility was not obviously related to the age of participants, scanner field strength, FreeSurfer software version, cortical regional measurement reliability, or regional size. These findings constitute an empirical illustration of reproducibility in the absence of publication bias or p hacking, when assessing realistic biological effects in heterogeneous neuroscience data, and given typically-used sample sizes
Genetic architecture of subcortical brain structures in 38,851 individuals
Subcortical brain structures are integral to motion, consciousness, emotions and learning. We identified common genetic variation related to the volumes of the nucleus accumbens, amygdala, brainstem, caudate nucleus, globus pallidus, putamen and thalamus, using genome-wide association analyses in almost 40,000 individuals from CHARGE, ENIGMA and UK Biobank. We show that variability in subcortical volumes is heritable, and identify 48 significantly associated loci (40 novel at the time of analysis). Annotation of these loci by utilizing gene expression, methylation and neuropathological data identified 199 genes putatively implicated in neurodevelopment, synaptic signaling, axonal transport, apoptosis, inflammation/infection and susceptibility to neurological disorders. This set of genes is significantly enriched for Drosophila orthologs associated with neurodevelopmental phenotypes, suggesting evolutionarily conserved mechanisms. Our findings uncover novel biology and potential drug targets underlying brain development and disease
Novel genetic loci associated with hippocampal volume
The hippocampal formation is a brain structure integrally involved in episodic memory, spatial navigation, cognition and stress responsiveness. Structural abnormalities in hippocampal volume and shape are found in several common neuropsychiatric disorders. To identify the genetic underpinnings of hippocampal structure here we perform a genome-wide association study (GWAS) of 33,536 individuals and discover six independent loci significantly associated with hippocampal volume, four of them novel. Of the novel loci, three lie within genes (ASTN2, DPP4 and MAST4) and one is found 200 kb upstream of SHH. A hippocampal subfield analysis shows that a locus within the MSRB3 gene shows evidence of a localized effect along the dentate gyrus, subiculum, CA1 and fissure. Further, we show that genetic variants associated with decreased hippocampal volume are also associated with increased risk for Alzheimer's disease (rg =-0.155). Our findings suggest novel biological pathways through which human genetic variation influences hippocampal volume and risk for neuropsychiatric illness
Genetic architecture of subcortical brain structures in 38,851 individuals
Subcortical brain structures are integral to motion, consciousness, emotions and learning. We identified common genetic variation related to the volumes of the nucleus accumbens, amygdala, brainstem, caudate nucleus, globus pallidus, putamen and thalamus, using genome-wide association analyses in almost 40,000 individuals from CHARGE, ENIGMA and UK Biobank. We show that variability in subcortical volumes is heritable, and identify 48 significantly associated loci (40 novel at the time of analysis). Annotation of these loci by utilizing gene expression, methylation and neuropathological data identified 199 genes putatively implicated in neurodevelopment, synaptic signaling, axonal transport, apoptosis, inflammation/infection and susceptibility to neurological disorders. This set of genes is significantly enriched for Drosophila orthologs associated with neurodevelopmental phenotypes, suggesting evolutionarily conserved mechanisms. Our findings uncover novel biology and potential drug targets underlying brain development and disease
Novel genetic loci underlying human intracranial volume identified through genome-wide association
Intracranial volume reflects the maximally attained brain size during development, and remains stable with loss of tissue in late life. It is highly heritable, but the underlying genes remain largely undetermined. In a genome-wide association study of 32,438 adults, we discovered five novel loci for intracranial volume and confirmed two known signals. Four of the loci are also associated with adult human stature, but these remained associated with intracranial volume after adjusting for height. We found a high genetic correlation with child head circumference (ρgenetic=0.748), which indicated a similar genetic background and allowed for the identification of four additional loci through meta-analysis (Ncombined = 37,345). Variants for intracranial volume were also related to childhood and adult cognitive function, Parkinson’s disease, and enriched near genes involved in growth pathways including PI3K–AKT signaling. These findings identify biological underpinnings of intracranial volume and provide genetic support for theories on brain reserve and brain overgrowth
- …