Reducing the environmental impact of surgery on a global scale: systematic review and co-prioritization with healthcare workers in 132 countries

Abstract Background Healthcare cannot achieve net-zero carbon without addressing operating theatres. The aim of this study was to prioritize feasible interventions to reduce the environmental impact of operating theatres. Methods This study adopted a four-phase Delphi consensus co-prioritization methodology. In phase 1, a systematic review of published interventions and global consultation of perioperative healthcare professionals were used to longlist interventions. In phase 2, iterative thematic analysis consolidated comparable interventions into a shortlist. In phase 3, the shortlist was co-prioritized based on patient and clinician views on acceptability, feasibility, and safety. In phase 4, ranked lists of interventions were presented by their relevance to high-income countries and low–middle-income countries. Results In phase 1, 43 interventions were identified, which had low uptake in practice according to 3042 professionals globally. In phase 2, a shortlist of 15 intervention domains was generated. In phase 3, interventions were deemed acceptable for more than 90 per cent of patients except for reducing general anaesthesia (84 per cent) and re-sterilization of ‘single-use’ consumables (86 per cent). In phase 4, the top three shortlisted interventions for high-income countries were: introducing recycling; reducing use of anaesthetic gases; and appropriate clinical waste processing. In phase 4, the top three shortlisted interventions for low–middle-income countries were: introducing reusable surgical devices; reducing use of consumables; and reducing the use of general anaesthesia. Conclusion This is a step toward environmentally sustainable operating environments with actionable interventions applicable to both high– and low–middle–income countries

ASPECTOS BIOLOGICOS DE Panacea prola amazonica (FRUHSTORFER) (LEPIDOPTERA: NYMPHALIDAE), EN LA AMAZONIA PERUANA

Los resultados del estudio muestran que Panacea prola amazonica copula entre el tercer y séptimo día de la emergencia. La oviposición, se realiza en hojas y ramas, está relacionada con la aparición de brotes de la planta hospedera “metohuayo” Caryodendron orinocense Karst. Su capacidad promedio de oviposición es de 262.80 ± 119.0 huevos. La duración del ciclo, desde huevo a adulto fue de 26 a 37 días, con 6 estadíos larvales.Los adultos nacen entre las 8.00 a 11.00 am, los machos sobreviven de 6 a 9 y las hembras aproximadamente 30 días en cautiverio. Se encontraron siete enemigos naturales, un parasitoide de huevo, tres parasitoides de larvas, un parasitoide de pre pupa, un depredador de larva, un depredador de adulto y un hongo entomopátogeno de pupa

Identificación genética de subpoblaciones de aedes aegypti en Cartagena de Indias – Colombia

INTRODUCCIÓN: el mosquito Aedes aegypti es el principal vector de la fiebre Dengue (FD) en ambientes urbanos y suburbanos enpaíses tropicales y subtropicales. Se estima que la FD infecta 50 millones de personas anualmente y más de quinientas milcontraen su forma más grave (PAHO 2008; Romano, 2010). En Colombia se notificaron 127.292 casos, 8.919 de dengue grave y 138muertes. El estudio de la variabilidad genética de una población de Ae. Aegypti permite identificar sub-poblaciones a través delespacio geográfico. Tal variación genética se ha relacionado con una expresión heterogénea en la capacidad vectorial del insectofrente a la FD debido a procesos de selección sobre serotipos virales circulantes aun a escala local.OBJETIVO: describir la variabilidad genética de Ae. Aegypti en Cartagena de Indias.MÉTODOS: estudio de corte transversal mediante un muestreo aleatorio por conglomerados que incluyó las 15 comunasadministrativas del distrito. 6300 viviendas fueron inspeccionadas mediante el protocolo de vigilancia entomológica dirigido alarvas de Ae. Aegypti. La implementación de las pruebas moleculares se realizó sobre 260 insectos de 36 sitios geográficosseleccionados al azar. La extracción del DNA genómico fue realizado mediante el método CTAB. La prueba RAPD PCR empleó losoligonucleótidos iniciadores: TTGCACCAACAGTCAATGTCTTCAGGTTC, CGTCTCAGTGATCCGGGGG y CGCCACAAGGGCCATGAACAG. Se realizó una electroforesis a los productos de amplificación RAPDs en un gel de agarosa al 1%, el cual fue conbromuro de etídio y fotodocumentado bajo luz UV. Las bandas obtenidas fueron asimiladas en una matriz binaria. Fueronutilizadas 1000 réplicas para obtener una matriz de distancia utilizando el paquete PHYLIP. El análisis filogenéticos se realizómediante el método de Neighbor-Joining y la visualización del árbol de consenso mediante el programa Tree view.RESULTADOS: 1361 viviendas fueron positivas a larvas del mosquito. Los perfiles RAPDs revelaron bandas de 200, 300, 500, 700 y800 pb. El análisis de filogenético reveló la existencia de 3 sub-poblaciones genéticamente diferenciables. Una primera sub -población integrada por las comunas 6, 8 y 12, una sub - población que integra las comunas 5, 6, 8 y 14; y una sub - poblaciónrepresentada por las comunas 1,2,3,4,7,9,10 11,13 y 15.CONCLUSIONES: los resultados obtenidos demuestran que la población local de Ae. aegypti en la ciudad de Cartagena esgenéticamente diversa, presentando sub-poblaciones que parecen influenciadas por el espacio geográfico. Observacionessimilares sobre poblaciones del vector a escala local se han descrito en la ciudad de Córdoba (Argentina), que muestran unarelación de la variabilidad en función de actividades humanas y disponibilidad de sitios de cría. La variabilidad intrapoblacional delos vectores en la ciudad de Cartagena estaría relacionada con el transporte pasivo de los insectos a través de la malla vial, lapresencia de los puertos marítimo, aéreo y terrestre. Por otra parte, los programas de control químico de vectores, así como ladisponibilidad de sitios de cría parecen ser tensores ambientales importantes sobre la población

Ecology of Rhodnius robustus Larrousse, 1927 (Hemiptera, Reduviidae, Triatominae) in Attalea palm trees of the Tapajós River Region (Pará State, Brazilian Amazon).

Submitted by Nuzia Santos ([email protected]) on 2015-02-09T17:05:20Z No. of bitstreams: 1 2014_058.pdf: 646393 bytes, checksum: 92255aada12093ee46f5ea948681bfbd (MD5)Approved for entry into archive by Nuzia Santos ([email protected]) on 2015-02-09T17:25:48Z (GMT) No. of bitstreams: 1 2014_058.pdf: 646393 bytes, checksum: 92255aada12093ee46f5ea948681bfbd (MD5)Approved for entry into archive by Nuzia Santos ([email protected]) on 2015-02-09T17:32:12Z (GMT) No. of bitstreams: 1 2014_058.pdf: 646393 bytes, checksum: 92255aada12093ee46f5ea948681bfbd (MD5)Made available in DSpace on 2015-02-09T17:32:12Z (GMT). No. of bitstreams: 1 2014_058.pdf: 646393 bytes, checksum: 92255aada12093ee46f5ea948681bfbd (MD5) Previous issue date: 2014Fundação Oswaldo Cruz. Centro de Pesquisa René Rachou. Laboratório de Triatomíneos e Epidemiologia da Doença de Chagas. Belo Horizonte, MG, Brazil/Diversité, Ecologie et Evolution des Insectes Tropicaux. Laboratoire Evolution Génome et Spéciation. Gif-sur-Yvette, FranceDiversité, Ecologie et Evolution des Insectes Tropicaux. Laboratoire Evolution Génome et Spéciation. Gif-sur-Yvette, France/Université de Neuchâtel. Institut de Biologie. Laboratoire Ecologie et Evolution des Parasites. Neuchâtel, SwitzerlandFundação Oswaldo Cruz. Centro de Pesquisa René Rachou. Laboratório de Triatomíneos e Epidemiologia da Doença de Chagas. Belo Horizonte, MG, BrazilUniversidad Simón Bolívar. Centro de Investigaciones. Barranquilla, ColombiaUniversité Paris Sud. UFR de Sciences. LEGS. Orsay, FranceCentro de Pesquisa em Biotecnologia. Belo Horizonte, MG, BrazilUniversité du Québec à Montréal. GÉOTOP & Institut des Sciences de l’Environnement. Montréal, Québec, Canada/Biodôme de Montréal. Montréal, Québec, CanadaUniversidade de Brasília. Centro de Desenvolvimento Sustentável. Brasília, DF, BrazilBiodôme de Montréal. Montréal,Québec, CanadaUniversité Paris Descartes/PRES Sorbonne Paris Cité. Paris, FranceBackground: The rising number of acute cases of Chagas disease in the State of Pará, reported in the past two decades, has been associated, in part, with the ingestion of juice of local palm tree fruits, mainly açaí berry and bacaba. Near the study area, in Santarém, Pará State, an outbreak of Chagas disease has been notified and investigations suggest the consumption of bacaba juice as the main source of infection with T. cruzi. The purpose of this study is to assess the aspects associated to the ecology of Rhodnius robustus in palm trees of three communities of the Tapajós region, in the State of Pará, Brazil. Methods: Palm trees were cut down and dissected to search for triatomines. DNA from triatomines was extracted to investigate natural infection by Trypanosoma cruzi and T. rangeli. For statistical analyzes, data from infestation of palm trees, as well as the rates of natural infection by T. cruziand T. rangeli were compared by Chi-square test. Triatomine density values were analyzed by the nonparametric Kruskal Wallis test and then comparisons between each pair of variables were made by the Mann–Whitney test assuming a confidence interval of 95%. Results: We dissected 136 palm trees, 60 at the end of the rainy period and 76 at the end of the dry period. Seventy-three of them (53.7%) were infested with triatomines and three species were found, namely: Rhodnius robustus, Rhodnius pictipes and Panstrongylus lignarius. We collected 743 triatomines, and R. robustus was predominant (n = 739). The identification of natural infection of the insects by trypanosomatids revealed that 125 triatomines were infected by T. cruzi, 69 by T. rangeli and 14 presented both parasites, indicating the presence of mixed infection in the same vector. Conclusion: The results suggest that São Tomé is the community with greater density of triatomines and infestation of palm trees; also, it demonstrates the existence of an intense sylvatic cycle in the region, which demands intensive surveillance to prevent human transmission

Resignificando los conceptos de la higiene: el surgimiento de una autoridad sanitaria en el Buenos Aires de los años 80 Resignifying hygienic concepts: the establishment of a sanitation authority in Buenos Aires in the 1880s

El trabajo aborda la emergencia de una autoridad sanitaria en la ciudad de Buenos Aires a fines del siglo XIX sobre la base de las ideas del higienismo decimonónico. Se enfocan las innovaciones de tipo científico-técnicas y políticas que se introdujeron y el rol que ejerció el proceso de profesionalización de la medicina en esta institución. La fisonomía que adquirió la política sanitaria en la ciudad de Buenos Aires, entre fines del siglo XIX y las primeras décadas del XX, sirvió para configurar un sistema de normas y arquetipos del cuerpo humano y su bienestar físico y mental.<br>The late nineteenth century saw the establishment of a sanitation authority in Buenos Aires, grounded on the ideas of nineteenth century hygienics. The article focuses on the scientific technical and political innovations that were introduced and on the role that the process of medical professionalization played within this institution. The features of sanitation policy that came to prevail in Buenos Aires at the turn on this century helped shape a system of standards and archetypes regarding the human body and its physical and mental well-being