43 research outputs found
First report of Rice yellow mottle virus on rice in Burundi
International audienceFirst Report of Rice yellow mottle virus on Rice in Burund
Rapid Ethical Appraisal: A tool to design a contextualized consent process for a genetic study of podoconiosis in Ethiopia
Background: Obtaining genuine informed consent from research participants in developing countries can be difficult, partly due to poor knowledge about research process and research ethics. The situation is complicated when conducting genomic research on a disease considered familial and a reason for stigmatisation.
Methods: We used a Rapid Ethical Appraisal tool to assess local factors that were barriers to getting genuine informed consent prior to conducting a genetic study of podoconiosis (non-filarial elephantiasis) in two Zones of Ethiopia. The tool included in-depth interviews and focus group discussions with patients, healthy community members, field workers, researchers/Institutional Review Board (IRB) members, elders, religious leaders, and podoconiosis administrators who work closely with patients.
Results: Most patients and healthy community members did not differentiate research from routine clinical diagnosis. Participants felt comfortable when approached in the presence of trusted community members. Field workers and podoconiosis administrators preferred verbal consent, whereas the majority of patients and healthy community members prefer both verbal and written consent.
Participants better understood genetic susceptibility concepts when analogies drawn from their day-to-day experience were used. The type of biological sample sought and gender were the two most important factors affecting the recruitment process. Most researchers and IRB members indicated that reporting incidental findings to participants is not a priority in an Ethiopian context.
Conclusions: Understanding the concerns of local people in areas where research is to be conducted facilitates the design of contextualized consent processes appropriate for all parties and will ultimately result in getting genuine consent
Rapid ethical assessment on informed consent content and procedure in Hintalo-Wajirat, Northern Ethiopia: a qualitative study
Background
Informed consent is a key component of bio-medical research involving human participants. However, obtaining informed consent is challenging in low literacy and resource limited settings. Rapid Ethical Assessment (REA) can be used to contextualize and simplify consent information within a given study community. The current study aimed to explore the effects of social, cultural, and religious factors during informed consent process on a proposed HPV-serotype prevalence study.
Methodology
A qualitative community-based REA was conducted in Adigudom and Mynebri Kebeles, Northern Ethiopia, from July to August 2013. Data were collected by a multi-disciplinary team using open ended questions concerning informed consent components in relation to the parent study. The team conducted one-to-one In-Depth Interviews (IDI) and Focus Group Discussions (FGDs) with key informants and community members to collect data based on the themes of the study. Tape recorded data were transcribed in Tigrigna and then translated into English. Data were categorized and thematically analyzed using open coding and content analysis based on pre-defined themes.
Results
The REA study revealed a number of socio-cultural issues relevant to the proposed study. Low community awareness about health research, participant rights and cervical cancer were documented. Giving a vaginal sample for testing was considered to be highly embarrassing, whereas giving a blood sample made participants worry that they might be given a result without the possibility of treatment. Verbal consent was preferred to written consent for the proposed study.
Conclusion
This rapid ethical assessment disclosed important socio-cultural issues which might act as barriers to informed decision making. The findings were important for contextual modification of the Information Sheet, and to guide the best consent process for the proposed study. Both are likely to have enabled participants to understand the informed consent better and consequently to comply with the study
Genetic parameters for milk urea concentration and milk traits in Polish Holstein-Friesian cows
The global burden of adolescent and young adult cancer in 2019 : a systematic analysis for the Global Burden of Disease Study 2019
Background In estimating the global burden of cancer, adolescents and young adults with cancer are often overlooked, despite being a distinct subgroup with unique epidemiology, clinical care needs, and societal impact. Comprehensive estimates of the global cancer burden in adolescents and young adults (aged 15-39 years) are lacking. To address this gap, we analysed results from the Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) 2019, with a focus on the outcome of disability-adjusted life-years (DALYs), to inform global cancer control measures in adolescents and young adults. Methods Using the GBD 2019 methodology, international mortality data were collected from vital registration systems, verbal autopsies, and population-based cancer registry inputs modelled with mortality-to-incidence ratios (MIRs). Incidence was computed with mortality estimates and corresponding MIRs. Prevalence estimates were calculated using modelled survival and multiplied by disability weights to obtain years lived with disability (YLDs). Years of life lost (YLLs) were calculated as age-specific cancer deaths multiplied by the standard life expectancy at the age of death. The main outcome was DALYs (the sum of YLLs and YLDs). Estimates were presented globally and by Socio-demographic Index (SDI) quintiles (countries ranked and divided into five equal SDI groups), and all estimates were presented with corresponding 95% uncertainty intervals (UIs). For this analysis, we used the age range of 15-39 years to define adolescents and young adults. Findings There were 1.19 million (95% UI 1.11-1.28) incident cancer cases and 396 000 (370 000-425 000) deaths due to cancer among people aged 15-39 years worldwide in 2019. The highest age-standardised incidence rates occurred in high SDI (59.6 [54.5-65.7] per 100 000 person-years) and high-middle SDI countries (53.2 [48.8-57.9] per 100 000 person-years), while the highest age-standardised mortality rates were in low-middle SDI (14.2 [12.9-15.6] per 100 000 person-years) and middle SDI (13.6 [12.6-14.8] per 100 000 person-years) countries. In 2019, adolescent and young adult cancers contributed 23.5 million (21.9-25.2) DALYs to the global burden of disease, of which 2.7% (1.9-3.6) came from YLDs and 97.3% (96.4-98.1) from YLLs. Cancer was the fourth leading cause of death and tenth leading cause of DALYs in adolescents and young adults globally. Interpretation Adolescent and young adult cancers contributed substantially to the overall adolescent and young adult disease burden globally in 2019. These results provide new insights into the distribution and magnitude of the adolescent and young adult cancer burden around the world. With notable differences observed across SDI settings, these estimates can inform global and country-level cancer control efforts. Copyright (C) 2021 The Author(s). Published by Elsevier Ltd.Peer reviewe
The global burden of cancer attributable to risk factors, 2010-19 : a systematic analysis for the Global Burden of Disease Study 2019
Background Understanding the magnitude of cancer burden attributable to potentially modifiable risk factors is crucial for development of effective prevention and mitigation strategies. We analysed results from the Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) 2019 to inform cancer control planning efforts globally. Methods The GBD 2019 comparative risk assessment framework was used to estimate cancer burden attributable to behavioural, environmental and occupational, and metabolic risk factors. A total of 82 risk-outcome pairs were included on the basis of the World Cancer Research Fund criteria. Estimated cancer deaths and disability-adjusted life-years (DALYs) in 2019 and change in these measures between 2010 and 2019 are presented. Findings Globally, in 2019, the risk factors included in this analysis accounted for 4.45 million (95% uncertainty interval 4.01-4.94) deaths and 105 million (95.0-116) DALYs for both sexes combined, representing 44.4% (41.3-48.4) of all cancer deaths and 42.0% (39.1-45.6) of all DALYs. There were 2.88 million (2.60-3.18) risk-attributable cancer deaths in males (50.6% [47.8-54.1] of all male cancer deaths) and 1.58 million (1.36-1.84) risk-attributable cancer deaths in females (36.3% [32.5-41.3] of all female cancer deaths). The leading risk factors at the most detailed level globally for risk-attributable cancer deaths and DALYs in 2019 for both sexes combined were smoking, followed by alcohol use and high BMI. Risk-attributable cancer burden varied by world region and Socio-demographic Index (SDI), with smoking, unsafe sex, and alcohol use being the three leading risk factors for risk-attributable cancer DALYs in low SDI locations in 2019, whereas DALYs in high SDI locations mirrored the top three global risk factor rankings. From 2010 to 2019, global risk-attributable cancer deaths increased by 20.4% (12.6-28.4) and DALYs by 16.8% (8.8-25.0), with the greatest percentage increase in metabolic risks (34.7% [27.9-42.8] and 33.3% [25.8-42.0]). Interpretation The leading risk factors contributing to global cancer burden in 2019 were behavioural, whereas metabolic risk factors saw the largest increases between 2010 and 2019. Reducing exposure to these modifiable risk factors would decrease cancer mortality and DALY rates worldwide, and policies should be tailored appropriately to local cancer risk factor burden. Copyright (C) 2022 The Author(s). Published by Elsevier Ltd. This is an Open Access article under the CC BY 4.0 license.Peer reviewe
Reducing the environmental impact of surgery on a global scale: systematic review and co-prioritization with healthcare workers in 132 countries
Background
Healthcare cannot achieve net-zero carbon without addressing operating theatres. The aim of this study was to prioritize feasible interventions to reduce the environmental impact of operating theatres.
Methods
This study adopted a four-phase Delphi consensus co-prioritization methodology. In phase 1, a systematic review of published interventions and global consultation of perioperative healthcare professionals were used to longlist interventions. In phase 2, iterative thematic analysis consolidated comparable interventions into a shortlist. In phase 3, the shortlist was co-prioritized based on patient and clinician views on acceptability, feasibility, and safety. In phase 4, ranked lists of interventions were presented by their relevance to high-income countries and low–middle-income countries.
Results
In phase 1, 43 interventions were identified, which had low uptake in practice according to 3042 professionals globally. In phase 2, a shortlist of 15 intervention domains was generated. In phase 3, interventions were deemed acceptable for more than 90 per cent of patients except for reducing general anaesthesia (84 per cent) and re-sterilization of ‘single-use’ consumables (86 per cent). In phase 4, the top three shortlisted interventions for high-income countries were: introducing recycling; reducing use of anaesthetic gases; and appropriate clinical waste processing. In phase 4, the top three shortlisted interventions for low–middle-income countries were: introducing reusable surgical devices; reducing use of consumables; and reducing the use of general anaesthesia.
Conclusion
This is a step toward environmentally sustainable operating environments with actionable interventions applicable to both high– and low–middle–income countries
Global, regional, and national progress towards Sustainable Development Goal 3.2 for neonatal and child health: all-cause and cause-specific mortality findings from the Global Burden of Disease Study 2019
Background Sustainable Development Goal 3.2 has targeted elimination of preventable child mortality, reduction of neonatal death to less than 12 per 1000 livebirths, and reduction of death of children younger than 5 years to less than 25 per 1000 livebirths, for each country by 2030. To understand current rates, recent trends, and potential trajectories of child mortality for the next decade, we present the Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) 2019 findings for all-cause mortality and cause-specific mortality in children younger than 5 years of age, with multiple scenarios for child mortality in 2030 that include the consideration of potential effects of COVID-19, and a novel framework for quantifying optimal child survival. Methods We completed all-cause mortality and cause-specific mortality analyses from 204 countries and territories for detailed age groups separately, with aggregated mortality probabilities per 1000 livebirths computed for neonatal mortality rate (NMR) and under-5 mortality rate (USMR). Scenarios for 2030 represent different potential trajectories, notably including potential effects of the COVID-19 pandemic and the potential impact of improvements preferentially targeting neonatal survival. Optimal child survival metrics were developed by age, sex, and cause of death across all GBD location-years. The first metric is a global optimum and is based on the lowest observed mortality, and the second is a survival potential frontier that is based on stochastic frontier analysis of observed mortality and Healthcare Access and Quality Index. Findings Global U5MR decreased from 71.2 deaths per 1000 livebirths (95% uncertainty interval WI] 68.3-74-0) in 2000 to 37.1 (33.2-41.7) in 2019 while global NMR correspondingly declined more slowly from 28.0 deaths per 1000 live births (26.8-29-5) in 2000 to 17.9 (16.3-19-8) in 2019. In 2019,136 (67%) of 204 countries had a USMR at or below the SDG 3.2 threshold and 133 (65%) had an NMR at or below the SDG 3.2 threshold, and the reference scenario suggests that by 2030,154 (75%) of all countries could meet the U5MR targets, and 139 (68%) could meet the NMR targets. Deaths of children younger than 5 years totalled 9.65 million (95% UI 9.05-10.30) in 2000 and 5.05 million (4.27-6.02) in 2019, with the neonatal fraction of these deaths increasing from 39% (3.76 million 95% UI 3.53-4.021) in 2000 to 48% (2.42 million; 2.06-2.86) in 2019. NMR and U5MR were generally higher in males than in females, although there was no statistically significant difference at the global level. Neonatal disorders remained the leading cause of death in children younger than 5 years in 2019, followed by lower respiratory infections, diarrhoeal diseases, congenital birth defects, and malaria. The global optimum analysis suggests NMR could be reduced to as low as 0.80 (95% UI 0.71-0.86) deaths per 1000 livebirths and U5MR to 1.44 (95% UI 1-27-1.58) deaths per 1000 livebirths, and in 2019, there were as many as 1.87 million (95% UI 1-35-2.58; 37% 95% UI 32-43]) of 5.05 million more deaths of children younger than 5 years than the survival potential frontier. Interpretation Global child mortality declined by almost half between 2000 and 2019, but progress remains slower in neonates and 65 (32%) of 204 countries, mostly in sub-Saharan Africa and south Asia, are not on track to meet either SDG 3.2 target by 2030. Focused improvements in perinatal and newborn care, continued and expanded delivery of essential interventions such as vaccination and infection prevention, an enhanced focus on equity, continued focus on poverty reduction and education, and investment in strengthening health systems across the development spectrum have the potential to substantially improve USMR. Given the widespread effects of COVID-19, considerable effort will be required to maintain and accelerate progress. Copyright (C) 2021 The Author(s). Published by Elsevier Ltd
Reducing the environmental impact of surgery on a global scale: systematic review and co-prioritization with healthcare workers in 132 countries
Abstract
Background
Healthcare cannot achieve net-zero carbon without addressing operating theatres. The aim of this study was to prioritize feasible interventions to reduce the environmental impact of operating theatres.
Methods
This study adopted a four-phase Delphi consensus co-prioritization methodology. In phase 1, a systematic review of published interventions and global consultation of perioperative healthcare professionals were used to longlist interventions. In phase 2, iterative thematic analysis consolidated comparable interventions into a shortlist. In phase 3, the shortlist was co-prioritized based on patient and clinician views on acceptability, feasibility, and safety. In phase 4, ranked lists of interventions were presented by their relevance to high-income countries and low–middle-income countries.
Results
In phase 1, 43 interventions were identified, which had low uptake in practice according to 3042 professionals globally. In phase 2, a shortlist of 15 intervention domains was generated. In phase 3, interventions were deemed acceptable for more than 90 per cent of patients except for reducing general anaesthesia (84 per cent) and re-sterilization of ‘single-use’ consumables (86 per cent). In phase 4, the top three shortlisted interventions for high-income countries were: introducing recycling; reducing use of anaesthetic gases; and appropriate clinical waste processing. In phase 4, the top three shortlisted interventions for low–middle-income countries were: introducing reusable surgical devices; reducing use of consumables; and reducing the use of general anaesthesia.
Conclusion
This is a step toward environmentally sustainable operating environments with actionable interventions applicable to both high– and low–middle–income countries
First Report of Rice yellow mottle virus on Rice in Burundi
Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the countr