62 research outputs found
Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations
Background: Although thalassemia is a genetic hemoglobinopathy
in Malaysia, there is limited data on thalassemia mutations
in the indigenous groups. This study aims to identify
the types of globin gene mutations in transfusion-dependent
patients in Northern Sarawak. Methods: Blood was collected
from 32 patients from the Malay, Chinese, Kedayan, Bisayah,
Kadazandusun, Tagal, and Bugis populations. The Ī±- and
Ī²-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten Ī²- and 2
previously reported Ī±-globin defects were identified. The Fil-ipino Ī²-deletion represented the majority of the Ī²-thalassemia
alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and
Tagal patients. The Ī²-globin gene mutations in the Chinese
patients were similar to the Chinese in West Malaysia. Hb Adana
(HBA2:c.179G>A) and the āĪ± 3.7 /Ī±Ī± deletion were detected
in 5 patients. A novel 24-bp deletion in the Ī±2-globin gene
(HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG)
was identified by sequencing. Co-inheritance of Ī±-thalassemia
with Ī²-thalassemia did not ameliorate the severity of
thalassemia major in the patients. Conclusion: The Filipino
Ī²-deletion was the most common gene defect observed. Homozygosity for the Filipino Ī²-deletion appears to be unique
to the Malays in Sarawak. Genomic sequencing is an essential
tool to detect rare genetic variants in the study of new populations
Contributions and complexities from the use of in-vivo animal models to improve understanding of human neuroimaging signals.
Many of the major advances in our understanding of how functional brain imaging signals relate to neuronal activity over the previous two decades have arisen from physiological research studies involving experimental animal models. This approach has been successful partly because it provides opportunities to measure both the hemodynamic changes that underpin many human functional brain imaging techniques and the neuronal activity about which we wish to make inferences. Although research into the coupling of neuronal and hemodynamic responses using animal models has provided a general validation of the correspondence of neuroimaging signals to specific types of neuronal activity, it is also highlighting the key complexities and uncertainties in estimating neural signals from hemodynamic markers. This review will detail how research in animal models is contributing to our rapidly evolving understanding of what human neuroimaging techniques tell us about neuronal activity. It will highlight emerging issues in the interpretation of neuroimaging data that arise from in-vivo research studies, for example spatial and temporal constraints to neuroimaging signal interpretation, or the effects of disease and modulatory neurotransmitters upon neurovascular coupling. We will also give critical consideration to the limitations and possible complexities of translating data acquired in the typical animals models used in this area to the arena of human fMRI. These include the commonplace use of anaesthesia in animal research studies and the fact that many neuropsychological questions that are being actively explored in humans have limited homologues within current animal models for neuroimaging research. Finally we will highlighting approaches, both in experimental animals models (e.g. imaging in conscious, behaving animals) and human studies (e.g. combined fMRI-EEG), that mitigate against these challenges
Phenomic analysis of chronic granulomatous disease reveals more severe integumentary infections in X-Linked compared with autosomal recessive chronic granulomatous disease
BACKGROUND : Chronic granulomatous disease (CGD) is an inborn error of immunity (IEI),
characterised by recurrent bacterial and fungal infections. It is inherited either in an Xlinked (XL) or autosomal recessive (AR) mode. Phenome refers to the entire set of
phenotypes expressed, and its study allows us to generate new knowledge of the
disease. The objective of the study is to reveal the phenomic differences between XL
and AR-CGD by using Human Phenotype Ontology (HPO) terms. METHODS : We collected data on 117 patients with genetically diagnosed CGD from Asia
and Africa referred to the Asian Primary Immunodeficiency Network (APID network). Only
90 patients with sufficient clinical information were included for phenomic analysis. We
used HPO terms to describe all phenotypes manifested in the patients.
RESULTS : XL-CGD patients had a lower age of onset, referral, clinical diagnosis, and
genetic diagnosis compared with AR-CGD patients. The integument and central nervous
system were more frequently affected in XL-CGD patients. Regarding HPO terms, perianal
abscess, cutaneous abscess, and elevated hepatic transaminase were correlated with
XL-CGD. A higher percentage of XL-CGD patients presented with BCGitis/BCGosis as
their first manifestation. Among our CGD patients, lung was the most frequently infected
organ, with gastrointestinal system and skin ranking second and third, respectively.
Aspergillus species, Mycobacterium bovis, and Mycobacteirum tuberculosis were the
most frequent pathogens to be found.
CONCLUSION : Phenomic analysis confirmed that XL-CGD patients have more recurrent
and aggressive infections compared with AR-CGD patients. Various phenotypic
differences listed out can be used as clinical handles to distinguish XL or AR-CGD
based on clinical features.The Society for Relief of Disabled Children and Jeffrey Modell Foundation.https://www.frontiersin.org/journals/immunologydm2022Paediatrics and Child Healt
Finishing the euchromatic sequence of the human genome
The sequence of the human genome encodes the genetic instructions for human physiology, as well as rich information about human evolution. In 2001, the International Human Genome Sequencing Consortium reported a draft sequence of the euchromatic portion of the human genome. Since then, the international collaboration has worked to convert this draft into a genome sequence with high accuracy and nearly complete coverage. Here, we report the result of this finishing process. The current genome sequence (Build 35) contains 2.85 billion nucleotides interrupted by only 341 gaps. It covers ā¼99% of the euchromatic genome and is accurate to an error rate of ā¼1 event per 100,000 bases. Many of the remaining euchromatic gaps are associated with segmental duplications and will require focused work with new methods. The near-complete sequence, the first for a vertebrate, greatly improves the precision of biological analyses of the human genome including studies of gene number, birth and death. Notably, the human enome seems to encode only 20,000-25,000 protein-coding genes. The genome sequence reported here should serve as a firm foundation for biomedical research in the decades ahead
Mitochondrial neurogastrointestinal encephalomyopathy disease in three siblings from Pakistan with a novel mutation
Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE) is a rare multisystem autosomal recessive disorder. The disease is clinically heterogeneous with gastrointestinal symptoms of intestinal dysmotility and cachexia as well as neurological symptoms of ophthalmoplegia, neuropathy, sensorineural hearing impairment, and diffuse leukoencephalopathy being most prominent. MNGIE is caused by mutations in TYMP , a gene that encodes thymidine phosphorylase (TP)-a cytosolic enzyme. Mutations in TYMP lead to very low TP catalytic activity, resulting in dramatically increased thymidine and deoxyuridine in plasma. We describe the clinical, biochemical, and neuroimaging findings of three boys with MNGIE from a Pakistani family with a novel homozygous mutation, c.798_801dupCGCG p. (Ala268Argfs*?), in exon 7 of TYM
Prevalence and Associated Factors of Frailty Among Elderly People inĀ Taiwan
Background: Frailty has begun to attract attention in recent years because it is associated with adverse health outcomes. The purpose of this study was to estimate the prevalence of frailty in elderly people in Taiwan and to examine the associated factors.
Methods: Data were extracted from a representative subsample of āThe Coming of an Aging Society: An Integrative Study on Social Planning in Taiwan in 2025ā that comprised 495 older adults. Multinomial logistic regression analyses were conducted to examine the relationships between frailty status and individual factors, health conditions, environmental factors, and activities.
Results: Among all the participants, 45.9% were classified as ānonfrailā, 45.9% exhibited āprefrailtyā, and 8.3% were āfrailā. After controlling for the dependent variables, the factors significantly influencing prefrailty were age [odds ratio (OR)Ā =Ā 1.07, pĀ <Ā 0.001], diabetes (ORĀ =Ā 2.18, pĀ <Ā 0.01), depressive syndrome (ORĀ =Ā 3.66, pĀ <Ā 0.001), and the number of activities in which the participants were involved (ORĀ =Ā 1.24, pĀ <Ā 0.05). The factors significantly influencing frailty were age (ORĀ =Ā 1.14, pĀ <Ā 0.001), non-Fukien ethnicity (ORĀ =Ā 3.01, pĀ <Ā 0.05), depressive syndrome (ORĀ =Ā 6.89, pĀ <Ā 0.001), diabetes (ORĀ =Ā 2.69, pĀ <Ā 0.05), and the number of activities in which the participants were involved (ORĀ =Ā 2.39, pĀ <Ā 0.001).
Conclusion: To prevent a decline in the functions of elderly people, the results of this study should be referenced when developing intervention strategies in which preventive actions are implemented to aid elderly people with particular risk factors such as diabetes, depression, and infrequent participation in social activities
Anti-Metastatic Effects of Antrodan with and without Cisplatin on Lewis Lung Carcinomas in a Mouse Xenograft Model
Antrodan, a unique protein-bound polysaccharide derived from the fungal mycelia of Antrodia cinnamomea, has been reported to exhibit antitumor and anti-metastatic effects on Lewis lung carcinoma (LLC) cells through direct action and immunomodulation in vitro. In this study, we investigated the combined treatment of antrodan with an anti-cancer drug—cisplatin—and its underlying molecular mechanisms of action in a mouse xenograft tumor model. C57BL/6 mice were implanted (s.c.) with LLCs for nine days, before administration with only antrodan (20 mg/kg and 40 mg/kg; p.o.) daily, only cisplatin (1 mg/kg; i.p.) twice per week, or a combination of both for an additional 28 days. As expected, antrodan on its own significantly inhibited metastasis of lung and liver tissues, while treatment with cisplatin only merely inhibited metastasis of the liver. Antrodan exhibited efficient adjuvant therapy in combination with cisplatin, by inhibiting the activities of the plasma urokinase plasminogen activator (uPA) and the liver matrix metalloproteinase 9 (MMP-9), as well as by inhibiting the phosphorylation of p38 and extracellular signal-regulated kinase 2 (ERK2) in lung and liver tissues. In addition, antrodan effectively ameliorated cisplatin-induced kidney dysfunction when treated combinatorially, as evidenced by a decrease in cisplatin-induced blood urea nitrogen (BUN) levels in plasma and in the level of p38 phosphorylation in the kidney. Mechanistically, the actions of antrodan on its own involved (i) reducing the activities of uPA and MMP-2 and -9 in plasma; (ii) reducing protein expression of MMP-2/9, and the phosphorylation of signal transducer and activator of transcription 3 (STAT3) and mitogen-activated protein kinases (MAPKs), including extracellular signal-regulated kinases (ERKs), c-Jun N-terminal kinases (JNKs), and p38 in lung and liver tissues; and (iii) enhancing immune system functions resulting in the promotion of an anti-metastatic response through immunomodulation, by increasing interferon-γ (IFN-γ) levels and decreasing interleukin-6 (IL-6) levels in plasma. These results demonstrated that antrodan provides a novel, complementary therapeutic strategy against cancer metastasis, by attenuating the activities of MMP-2 and -9 through the modulation of STAT3/MAPK/ERK/JNK signaling pathways, and of the host’s immune system
Inherited metabolic disorders presenting as hypoxic ischaemic encephalopathy: A case series of patients presenting at a tertiary care hospital in Pakistan
In spite of the efforts and interventions by the Government of Pakistan and The World Health Organization, the neonatal mortality in Pakistan has declined by only 0.9% as compared to the global average decline of 2.1% between 2000 and 2010. This has resulted in failure to achieve the global Millennium Development Goal 4. Hypoxic-ischaemic encephalopathy, still birth, sepsis, pneumonia, diarrhoea and birth defects are commonly attributed as leading causes of neonatal mortality in Pakistan. Inherited metabolic disorders often present at the time of birth or the first few days of life. The clinical presentation of the inherited metabolic disorders including hypotonia, seizure and lactic acidosis overlap with clinical features of hypoxic-ischaemic encephalopathy and sepsis. Thus, these disorders are often either missed or wrongly diagnosed as hypoxicischaemic encephalopathy or sepsis unless the physicians actively investigate for the underlying inherited metabolic disorders. We present 4 neonates who had received the diagnosis of hypoxic-ischaemic encephalopathy and eventually were diagnosed to have various inherited metabolic disorders. Neonates with sepsis and hypoxic-ischaemic encephalopathy-like clinical presentation should be evaluated for inherited metabolic disorders
Chitosan Augments Photodynamic Inactivation of Gram-Positive and Gram-Negative Bacteriaāæā
Antimicrobial photodynamic inactivation (PDI) was shown to be a promising treatment modality for microbial infections. This study explores the effect of chitosan, a polycationic biopolymer, in increasing the PDI efficacy against Gram-positive bacteria, including Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pyogenes, and methicillin-resistant S. aureus (MRSA), as well as the Gram-negative bacteria Pseudomonas aeruginosa and Acinetobacter baumannii. Chitosan at <0.1% was included in the antibacterial process either by coincubation with hematoporphyrin (Hp) and subjection to light exposure to induce the PDI effect or by addition after PDI and further incubation for 30 min. Under conditions in which Hp-PDI killed the microbe on a 2- to 4-log scale, treatment with chitosan at concentrations of as low as 0.025% for a further 30 min completely eradicated the bacteria (which were originally at ā¼108 CFU/ml). Similar results were also found with toluidine blue O (TBO)-mediated PDI in planktonic and biofilm cells. However, without PDI treatment, chitosan alone did not exert significant antimicrobial activity with 30 min of incubation, suggesting that the potentiated effect of chitosan worked after the bacterial damage induced by PDI. Further studies indicated that the potentiated PDI effect of chitosan was related to the level of PDI damage and the deacetylation level of the chitosan. These results indicate that the combination of PDI and chitosan is quite promising for eradicating microbial infections
Dihydropyrimidine Dehydrogenase Deficiency in Two Malaysian Siblings with Abnormal MRI Findings
Dihydropyrimidine dehydrogenase (DPD) deficiency is an autosomal recessive disorder of the pyrimidine metabolism. Deficiency of this enzyme leads to an accumulation of thymine and uracil and a deficiency of metabolites distal to the catabolic enzyme. The disorder presents with a wide clinical spectrum, ranging from asymptomatic to severe neurological manifestations, including intellectual disability, seizures, microcephaly, autistic behavior, and eye abnormalities. Here, we report on an 11-year-old Malaysian girl and her 6-year-old brother with DPD deficiency who presented with intellectual disability, microcephaly, and hypotonia. Brain MRI scans showed generalized cerebral and cerebellar atrophy and callosal body dysgenesis in the boy. Urine analysis showed strongly elevated levels of uracil in the girl and boy (571 and 578 mmol/mol creatinine, respectively) and thymine (425 and 427 mmol/mol creatinine, respectively). Sequence analysis of the DPYD gene showed that both siblings were homozygous for the mutation c.1651G>A (pAla551Thr
- ā¦