The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

Effects of ionizing radiation on charge-coupled imagers

The effects of ionizing radiation on three different charge coupled imagers have been investigated. Device performance was evaluated as a function of total gamma ray dose. The principal failure mechanisms have been identified for each particular device structure. The clock and bias voltages required for high total dose operation of the devices are presented

Le partenariat orthophoniste – psychologue dans la prise en charge d’un déficit d’expression

Parfois la prise en charge orthophonique rencontre une limite qui est l’aspect psychologique de la problématique. Le travail en collaboration avec un psychologue peut s’avérer nécessaire mais rencontre un certain nombre de contraintes qui rendent impossible cette participation. Cet article présente un outil qui encourage l’expression d’une problématique psychologique et éventuellement des réajustements internes à la personne sans intervention extérieure. Pour ce faire, l’Epreuve des Trois Arbres utilise la médiation de l’arbre, favorise le discours subjectif en écartant tout jugement. L’arbre a été choisi en raison des nombreuses analogies que l’esprit établit spontanément entre un être humain et un arbre. Suite à un accompagnement orthophonique, l’étude de cas présentée retrace une pratique qui comprend une phase test avec l’Epreuve des Trois Arbres, un accompagnement personnalisé basé sur la production de saynètes centrées sur le thème de l’arbre et une phase retest. L’approche phénoménologique qui vise l’expression d’un discours subjectif, a permis une évolution considérable du cas présenté en réinstallant des voies de sens depuis le point de vue du sujet. L’Epreuve des Trois Arbres constitue un outil pour dépasser des limitations disciplinaires au service de la personne

An OBIA for fine-scale land cover spatial analysis over broad territories: demonstration through riparian corridor and artificial sprawl studies in France

International audienceSpatial analysis using fine-scale information over broad territories is essential to define efficient restoration strategies from local to national scale. We designed an OBIA dedicated to produce operationally reliable fine-scale information over broad territories. The originality of our OBIA lies particularly in the top-down approach for the construction of the classification tree and the use of „knowledge-based rules‟ classification technique. The implementation of this OBIA over the two study areas – (i) the Normandy region for riparian area land cover mapping (5600 km² riparian area) and (ii) fours departments over the Languedoc-Roussillon region (22644 km²) – demonstrates the operability of our approach (time-efficient, reproducible, transferable, portable). Broad scale spatial analysis conducted from resulting maps demonstrate the interest of using fine-scale information and highlight that OBIA, following our approach, will be at very short run a broadly applicable method to carry out such analysis

Ancestral genome estimation reveals the history of ecological diversification in Agrobacterium

Horizontal gene transfer (HGT) is considered as a major source of innovation in bacteria, and as such is expected to drive adaptation to new ecological niches. However, among the many genes acquired through HGT along the diversification history of genomes, only a fraction may have actively contributed to sustained ecological adaptation. We used a phylogenetic approach accounting for the transfer of genes (or groups of genes) to estimate the history of genomes in Agrobacterium biovar 1, a diverse group of soil and plant-dwelling bacterial species. We identified clade-specific blocks of cotransferred genes encoding coherent biochemical pathways that may have contributed to the evolutionary success of key Agrobacterium clades. This pattern of gene coevolution rejects a neutral model of transfer, in which neighboring genes would be transferred independently of their function and rather suggests purifying selection on collectively coded acquired pathways. The acquisition of these synapomorphic blocks of cofunctioning genes probably drove the ecological diversification of Agrobacterium and defined features of ancestral ecological niches, which consistently hint at a strong selective role of host plant rhizospheres

Enhanced nicotinic receptor mediated relaxations in gastroesophageal muscle fibers from Barrett\u27s esophagus patients

BACKGROUND: Increased nicotinic receptor mediated relaxation in the gastroesophageal antireflux barrier may be involved in the pathophysiology of reflux. This study is designed to determine whether the defects we previously identified in GERD patients in-vivo are due to abnormalities of the gastric sling, gastric clasp or lower esophageal circular (LEC) muscle fibers. METHODS: Muscle strips from whole stomachs and esophagi were obtained from 16 normal donors and 15 donors with histologically proven Barrett's esophagus. Contractile and relaxant responses of gastric sling, gastric clasp or LEC fibers were determined to increasing concentrations of carbachol and to nicotine after inducing maximal contraction to bethanechol. Muscarinic receptor density was measured using subtype selective immunoprecipitation. KEY RESULTS: Barrett's esophagus gastric sling and LEC fibers have decreased carbachol induced contractions. Barrett's esophagus sling fibers have decreased M(2) muscarinic receptors and LEC fibers have decreased M(3) receptors. Relaxations of all 3 fiber types are greater in Barrett's esophagus specimens to both high carbachol concentrations and to nicotine following bethanechol pre-contraction. The maximal response to bethanechol is greater in Barrett esophagus sling and LEC fibers. CONCLUSIONS & INFERENCES: The increased contractile response to bethanechol in Barrett's specimens indicates that the defect is likely not due to the smooth muscle itself. The enhanced nicotinic receptor mediated response may be involved in greater relaxation of the muscles within the high pressure zone of the gastroesophageal junction during transient lower esophageal sphincter relaxations and during deglutitive inhibition and may be involved in the pathophysiology of gastro esophageal reflux disease

High-pressure batch reverse osmosis (RO) for zero liquid discharge (ZLD) in a Cr(III) electroplating process

A batch RO system was designed and built for high-pressure (120 bar) operation. The system was developed for a ZLD application involving treatment of metal plating wastewater from a Cr(III) electroplating process at a major industrial plant. Hybrid semi-batch/batch operation enabled a compact design to be achieved. To maximize water recovery without exceeding a set peak pressure, a method for controlling the switch point between semi-batch and batch phases was developed. The system was tested with feed representative of rinse water from the electroplating process. A range of feed concentrations (at 10–20× dilution of the plating bath), feed flows (0.21–0.46 m3/h), water fluxes (6–14 LMH) and water recoveries (87–95.7 %) were investigated. The system successfully recovered Cr(III) and restored its concentration to that of the electrolyte bath, thus meeting the requirements for reuse in the electroplating process. Rejection of most species was >99.8 %, sufficient for reuse of the permeate as rinse. However, rejection of boric acid was only 69–80 % such that a second RO pass may be needed to remove boric acid. Specific Energy Consumption was <2.25 kWh per m3 of treated rinse water, representing a 50-fold saving compared to the current method of treatment and disposal at the industrial plant

Acute effects of a selective cannabinoid-2 receptor agonist on neuroinflammation in a model of traumatic brain injury.

Proposed therapeutic strategies for attenuating secondary traumatic brain injury (TBI) include modulation of acute neuroimmune responses. The goal of this study was to examine the acute effects of cannabinoid-2 receptor (CB(2)R) modulation on behavioral deficits, cerebral edema, perivascular substance P, and macrophage/microglial activation in a murine model of TBI. Thirty male C57BL/6 mice underwent sham surgery, or cortical contusion impact injury (CCI). CCI mice received vehicle or the CB(2)R agonist 0-1966 at 1 and 24 h after injury. Performance on the rotarod, forelimb cylinder, and open-field tests were evaluated before and at 48 h after sham or CCI surgery. Cerebral edema was evaluated using the wet-dry weight technique. Immunohistochemical analysis was used to examine changes in substance P and macrophage/microglia-specific Iba1 protein immunoreactivity. Locomotor performance and exploratory behavior were significantly improved in mice receiving 0-1966 (CB(2)R agonist) compared to vehicle-treated mice. Significant reductions were found for cerebral edema, number of perivascular areas of substance P immunoreactivity, and number of activated macrophages/microglial cells in the injured brains of 0-1966-treated mice compared to vehicle-treated mice. The findings show that the effects of the CB(2)R agonist 0-1966 on edema, substance P immunoreactivity, and macrophage/microglial activation, were associated with recovery of acute motor and exploratory deficits. This study provides evidence of acute neuroprotective effects derived from selective CB(2)R activation that may represent an avenue for further development of novel therapeutic agents in the treatment of TBI

Development of a new chlamydiales-specific real-time PCR and its application to respiratory clinical samples.

Originally composed of the single family Chlamydiaceae, the Chlamydiales order has extended considerably over the last several decades. Chlamydia-related bacteria were added and classified into six different families and family-level lineages: the Criblamydiaceae, Parachlamydiaceae, Piscichlamydiaceae, Rhabdochlamydiaceae, Simkaniaceae, and Waddliaceae. While several members of the Chlamydiaceae family are known pathogens, recent studies showed diverse associations of Chlamydia-related bacteria with human and animal infections. Some of these latter bacteria might be of medical importance since, given their ability to replicate in free-living amoebae, they may also replicate efficiently in other phagocytic cells, including cells of the innate immune system. Thus, a new Chlamydiales-specific real-time PCR targeting the conserved 16S rRNA gene was developed. This new molecular tool can detect at least five DNA copies and show very high specificity without cross-amplification from other bacterial clade DNA. The new PCR was validated with 128 clinical samples positive or negative for Chlamydia trachomatis or C. pneumoniae. Of 65 positive samples, 61 (93.8%) were found to be positive with the new PCR. The four discordant samples, retested with the original test, were determined to be negative or below detection limits. Then, the new PCR was applied to 422 nasopharyngeal swabs taken from children with or without pneumonia; a total of 48 (11.4%) samples were determined to be positive, and 45 of these were successfully sequenced. The majority of the sequences corresponded to Chlamydia-related bacteria and especially to members of the Parachlamydiaceae family

Twitching and swimming motility play a role in Ralstonia solanacearum pathogenicity

Ralstonia solanacearum is a bacterial plant pathogen causing important economic losses worldwide. In addition to the polar flagella responsible for swimming motility, this pathogen produces type IV pili (TFP) that govern twitching motility, a flagellum-independent movement on solid surfaces. The implication of chemotaxis in plant colonization, through the control flagellar rotation by the proteins CheW and CheA, has been previously reported in R. solanacearum. In this work, we have identified in this bacterium homologues of the Pseudomonas aeruginosa pilI and chpA genes, suggested to play roles in TFP-associated motility analogous to those played by the cheW and cheA genes, respectively. We demonstrate that R. solanacearum strains with a deletion of the pilI or the chpA coding region show normal swimming and chemotaxis but altered biofilm formation and reduced twitching motility, transformation efficiency, and root attachment. Furthermore, these mutants displayed wild-type growth in planta and impaired virulence on tomato plants after soil-drench inoculations but not when directly applied to the xylem. Comparison with deletion mutants for pilA and fliC encoding the major pilin and flagellin subunits, respectively showed that both twitching and swimming are required for plant colonization and full virulence. This work proves for the first time the functionality of a pilus-mediated pathway encoded by pil-chp genes in R. solanacearum, demonstrating that pilI and chpA genes are bona fide motility regulators controlling twitching motility and its three related phenotypes: virulence, natural transformation, and biofilm formation