Mechanical unfolding of RNA: From hairpins to structures with internal multiloops

Mechanical unfolding of RNA structures, ranging from hairpins to ribozymes, using laser optical tweezer (LOT) experiments have begun to reveal the features of the energy landscape that cannot be easily explored using conventional experiments. Upon application of constant force ($f$), RNA hairpins undergo cooperative transitions from folded to unfolded states whereas subdomains of ribozymes unravel one at a time. Here, we use a self-organized polymer (SOP) model and Brownian dynamics simulations to probe mechanical unfolding at constant force and constant-loading rate of four RNA structures of varying complexity. Our work shows (i) the response of RNA to force is largely determined by the native structure; (ii) only by probing mechanical unfolding over a wide range of forces can the underlying energy landscape be fully explored.Comment: 26 pages, 6 figures, Biophys. J. (in press

Forced-unfolding and force-quench refolding of RNA hairpins

Using coarse-grained model we have explored forced-unfolding of RNA hairpin as a function of $f_S$ and the loading rate ($r_f$). The simulations and theoretical analysis have been done without and with the handles that are explicitly modeled by semiflexible polymer chains. The mechanisms and time scales for denaturation by temperature jump and mechanical unfolding are vastly different. The directed perturbation of the native state by $f_S$ results in a sequential unfolding of the hairpin starting from their ends whereas thermal denaturation occurs stochastically. From the dependence of the unfolding rates on $r_f$ and $f_S$ we show that the position of the unfolding transition state (TS) is not a constant but moves dramatically as either $r_f$ or $f_S$ is changed. The TS movements are interpreted by adopting the Hammond postulate for forced-unfolding. Forced-unfolding simulations of RNA, with handles attached to the two ends, show that the value of the unfolding force increases (especially at high pulling speeds) as the length of the handles increases. The pathways for refolding of RNA from stretched initial conformation, upon quenching $f_S$ to the quench force $f_Q$, are highly heterogeneous. The refolding times, upon force quench, are at least an order of magnitude greater than those obtained by temperature quench. The long $f_Q$-dependent refolding times starting from fully stretched states are analyzed using a model that accounts for the microscopic steps in the rate limiting step which involves the trans to gauche transitions of the dihedral angles in the GAAA tetraloop. The simulations with explicit molecular model for the handles show that the dynamics of force-quench refolding is strongly dependent on the interplay of their contour length and the persistence length, and the RNA persistence length.Comment: 42 pages, 15 figures, Biophys. J. (in press

Solution structure of an alternate conformation of helix27 from Escherichia coli 16S rRNA

Helix (H)27 of 16S ribosomal (r)RNA from Escherichia coli was dubbed the “switch helix” when mutagenesis suggested that two alternative base pair registers may have distinct functional roles in the bacterial ribosome. Although more recent genetic analyses suggest that H27 conformational switching is not required for translation, previous solution studies demonstrated that the isolated E. coli H27 can dynamically convert between the 885 and 888 conformations. Here, we have solved the nuclear magnetic resonance solution structure of a locked 888 conformation. NOE and residual dipolar coupling restraints reveal an architecture that markedly differs from that of the 885 conformation found in crystal structures of the bacterial ribosome. In place of the loop E motif that characterizes the 885 conformer and that the 888 conformer cannot adopt, we find evidence for an asymmetrical A‐rich internal loop stabilized by stacking interactions among the unpaired A's. Comparison of the isolated H27 888 solution structure with the 885 crystal structure within the context of the ribosome suggests a difference in overall length of H27 that presents one plausible reason for the absence of H27 conformational switching within the sterically confining ribosome. © 2011 Wiley Periodicals, Inc. Biopolymers 95: 653–668, 2011.Peer Reviewedhttp://deepblue.lib.umich.edu/bitstream/2027.42/86980/1/21626_ftp.pd

The structure of the human tRNALys3 anticodon bound to the HIV genome is stabilized by modified nucleosides and adjacent mismatch base pairs

Replication of human immunodeficiency virus (HIV) requires base pairing of the reverse transcriptase primer, human tRNALys3, to the viral RNA. Although the major complementary base pairing occurs between the HIV primer binding sequence (PBS) and the tRNA's 3′-terminus, an important discriminatory, secondary contact occurs between the viral A-rich Loop I, 5′-adjacent to the PBS, and the modified, U-rich anticodon domain of tRNALys3. The importance of individual and combined anticodon modifications to the tRNA/HIV-1 Loop I RNA's interaction was determined. The thermal stabilities of variously modified tRNA anticodon region sequences bound to the Loop I of viral sub(sero)types G and B were analyzed and the structure of one duplex containing two modified nucleosides was determined using NMR spectroscopy and restrained molecular dynamics. The modifications 2-thiouridine, s2U34, and pseudouridine, Ψ39, appreciably stabilized the interaction of the anticodon region with the viral subtype G and B RNAs. The structure of the duplex results in two coaxially stacked A-form RNA stems separated by two mismatched base pairs, U162•Ψ39 and G163•A38, that maintained a reasonable A-form helix diameter. The tRNA's s2U34 stabilized the interaction between the A-rich HIV Loop I sequence and the U-rich anticodon, whereas the tRNA's Ψ39 stabilized the adjacent mismatched pairs

The 3′ Splice Site of Influenza A Segment 7 mRNA Can Exist in Two Conformations: A Pseudoknot and a Hairpin

The 3′ splice site of influenza A segment 7 is used to produce mRNA for the M2 ion-channel protein, which is critical to the formation of viable influenza virions. Native gel analysis, enzymatic/chemical structure probing, and oligonucleotide binding studies of a 63 nt fragment, containing the 3′ splice site, key residues of an SF2/ASF splicing factor binding site, and a polypyrimidine tract, provide evidence for an equilibrium between pseudoknot and hairpin structures. This equilibrium is sensitive to multivalent cations, and can be forced towards the pseudoknot by addition of 5 mM cobalt hexammine. In the two conformations, the splice site and other functional elements exist in very different structural environments. In particular, the splice site is sequestered in the middle of a double helix in the pseudoknot conformation, while in the hairpin it resides in a two-by-two nucleotide internal loop. The results suggest that segment 7 mRNA splicing can be controlled by a conformational switch that exposes or hides the splice site

Hydrogen bonds in RNA base pairs investigated by cross-correlated relaxation of multiple-quantum coherence in NMR

Cross-correlated relaxation of multiple-quantum coherences in NMR was used to investigate hydrogen bonds in Watson-Crick base pairs, based on the interference between various relaxation mechanisms. [on SciFinder (R)

UBS - Rebuilding trust: how the board and management initiated change through corporate communication

This case study aims at analyzing the ongoing change process of one of the world’s largest banks by focusing on how the Swiss bank reacted to rebuild trust after a severe loss of reputation during the financial crisis. Reputation is an essential asset for a financial intermediary, especially within the core business wealth management. The variety of underlying activities, causes and reactions to the crisis, as well as potential challenges lying ahead, make this case interesting for several fields of investigation. In particular, the present case study adds value to in-depth discussions relating to the banking sector with a focus on the perspective of the board, the management or the analyst. In summery, this case is suitable for courses within the Master of Business Administration (MBA), Master of Science (Msc), elective Master of Arts (MA) and for executive courses. Knowledge of banking and general management is an advantage, but not a necessary precondition

I consiglieri irrazionali: la behavioral corporate governance può spiegare la crisi?

Come sta cambiando la relazione tra banche e imprese in termini di contributo alla stabilità finanziaria e alla crescita economica? Quali sono le incognite nell’attuale crisi dei mercati? E i percorsi evolutivi verso la ripresa? Sono queste le domande che fanno da filo conduttore al Diciassettesimo Rapporto sul Sistema Finanziario della Fondazione Rosselli. Partendo, infatti, dal modello di banca commerciale territoriale (Bct) – tratto distintivo dell’industria bancaria italiana – autorevoli esperti del mondo delle banche, delle istituzioni e delle università ne indagano peculiarità e reazioni alla crisi lungo tre direttrici principali: stabilità finanziaria; crescita e innovazione delle imprese; ruolo dello Stato. Sul primo aspetto, il Rapporto conferma il contributo del modello Bct alla stabilità sistemica, in grado cioè di garantire una dinamica sana degli impieghi e del risparmio, grazie anche al ruolo delle banche di dimensioni medie e piccole. Oggi tuttavia le banche si trovano a fare i conti con l’incognita della redditività e diventa fondamentale intervenire sull’efficienza e sull’innovazione nei servizi e nell’organizzazione per migliorare i risultati. Qual è la relazione tra modello Bct e innovazione e internazionalizzazione del tessuto produttivo italiano? Essa risulta tanto più robusta quanto più il modello viene assunto anche dalle grandi banche. Inoltre, la costituzione di reti di imprese, il supporto dei Confidi, l’internazionalizzazione delle stesse banche sono tutti fattori di spinta alla capacità di innovare e di esportare. Infine, il Rapporto analizza il nuovo ruolo dello Stato nella Grande Crisi nella doppia veste di regolatore e proprietario, soffermandosi in particolare sui limiti manifestati dall’approccio prudenziale e sui relativi rimedi per arrivare a una riforma mirata delle regole e dei controll

Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

The temp. dependence of internucleotide nitrogen-nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine-uracil (A-U) and guanine-cytosine (G-C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was obsd. to decrease monotonically for all four base pairs with increasing temp. The temp. dependence of 2hJ(N,N) was found to be more pronounced for the A-U base pair than for G-C base pairs. An earlier study of cross-correlation effects at 296 K appeared to indicate a reduced mobility of the A-U base pair, as evidenced by small contributions of chem. shift modulation to relaxation rates. [on SciFinder (R)