Plan de auditoría para el programa de auditoría interna de la compañía lácteos Altagracia, línea de producción del queso prensado.

Implementación del sistemas HACCP y la normas ISO 22000:2018 ISO 14001:2015, en la empresa Lácteos Altagracia , en la línea de queso prensado para la perfección del sistema de gestión ,basado en la preparación de auditorías internas.Implementation of HACCP systems and ISO 22000.2018 standard ISO 14001:2014, in the Dairy company Altagracia , inte line of perfection of the management system,, based on the preparation of internal audits

Accuracy and consistency of grass pollen identification by human analysts using electron micrographs of surface ornamentation

• Premise of the study: Humans frequently identify pollen grains at a taxonomic rank above species. Grass pollen is a classic case of this situation, which has led to the development of computational methods for identifying grass pollen species. This paper aims to provide context for these computational methods by quantifying the accuracy and consistency of human identification. • Methods: We measured the ability of nine human analysts to identify 12 species of grass pollen using scanning electron microscopy images. These are the same images that were used in computational identifications. We have measured the coverage, accuracy, and consistency of each analyst, and investigated their ability to recognize duplicate images. • Results: Coverage ranged from 87.5% to 100%. Mean identification accuracy ranged from 46.67% to 87.5%. The identification consistency of each analyst ranged from 32.5% to 87.5%, and each of the nine analysts produced considerably different identification schemes. The proportion of duplicate image pairs that were missed ranged from 6.25% to 58.33%. • Discussion: The identification errors made by each analyst, which result in a decline in accuracy and consistency, are likely related to psychological factors such as the limited capacity of human memory, fatigue and boredom, recency effects, and positivity bias

Investigación de mercado para determinar la preferencia de consumo de las gaseosas Postobón, en presentaciones personales y pequeñas

Esta investigación de mercados permite determinar la preferencia de consumo de gaseosas en presentación personales y pequeñas; así mismo, el principal objetivo es identificar cual es el tamaño preferido por los consumidores en envases de 250 cc, 350cc y 500 cc en el Barrio el Tunal de la ciudad de Bogotá. Igualmente, los resultados son muy importantes al momento de sistematizar la información, lo cual permite identificar el género más recurrente al consumo de bebidas gaseosas y qué tipo de recipiente es el más apetecido; lo anterior en un rango de edad entre los 15 a 45 años. De los tres envases analizados, uno cuenta con mayor predilección en relación con los demás; sin embargo, los dos restantes no están muy alejados de la preferencia en el consumo. Por otro lado, con el fin de incrementar las ventas en un 5%, se propone negociar con estaciones de servicio las cuales cuentan con un tráfico de clientes fluido, la implementación de un dispensador de gaseosas, el cual brinde esencialmente el envase preferido por los consumidores. Finalmente, la política pública establece poder llevar una sana alimentación a los clientes disminuyendo la obesidad en el país. “El Plan Decenal de Salud Pública 2012-2021, entre las metas del objetivo de seguridad alimentaria, estableció lograr que la población colombiana consuma una alimentación completa, equilibrada, suficiente y adecuada y disminuir la prevalencia de sobrepeso y obesidad en hombres de 18 a 64 años a 35,9 %, en mujeres de 18 a 64 años a 44,6 % y en mujeres de 13 a 49 años a 30,2 % en 2015” (Nacional, 2013). En tal sentido, el presente estudio se alinea a los estándares propuestos por dicho plan. PALABRAS CLAVES: Bebidas carbonatadas, envases, ventas, investigación de mercados, política pública, consumidor.This market research allows to determine the preference in soft drinks consumption in personal and small presentation bottles; likewise, its main aim is to identify which is the bottle size preferred by consumers among 250cc, 350cc, and 500cc containers, in El Tunal neighbourhood in the city of Bogotá. Eventually, the results are quite important when systematizing the information, which permits to identify the most recurrent genre towards consuming soft drinks and which recipient is the most wanted; the above in an age range between 15 and 45 years. Among the three analysed bottles, one counts with more predilection in relation to the others; however, the two left are not distant in consumption preference. On the other hand, aiming to increase sales by 5%, it is proposed to negotiate with service stations with a fluid client traffic, the implementation of a soda dispenser to bring essentially the most favourite bottle to consumers. Finally, the public policy establishes being able to achieve a healthy eating and reduce the obesity levels within the country. The Ten-Year Public Health Plan 2012-2021, among the goals of food security objective, established “to ensure that the Colombian population consume a complete, balanced, sufficient, and adequate diet and reduce the prevalence of overweight and obesity in men aged 18 to 64 to 35.9%, in women aged 18 to 64 to 44.6%, and women aged 13 to 49 to 30.2% in 2015. (Nacional, 2013). Therefore, this study aligns to the standards proposed by the aforementioned plan. KEY WORDS: Soft drinks, recipients, sales, market research, public policy, consume

Investigation of Solar Energy: The Case Study in Malaysia, Indonesia, Colombia and Nigeria

In the present scenario of world (a growing world population & developing countries), the increasing consumption of electricity controls the progress of different forms of energy (renewable or nonrenewable energy) use around the world. Fossil fuels are non-renewable sources, and accounted for 81 % of total energy demand in 2017. However, there are some disadvantages associated with their use such as environmental pollution, emissions of greenhouse gasses, and they are depleting at a faster rate. Therefore, researchers have to work hard in order to find an alternative (such as solar energy) way for fossil fuel to generate energy. A large number of investigations on the solar energy have been carried out by many researchers in order to improve the living conditions, to help reduce air pollution and to go green. The purpose of work is to explore the current status, challenges, recent efforts and future prospects of solar energy in different countries including Malaysia, Indonesia (Asia region), Nigeria (Africa region) and Colombia (South America)

Intervención educativa sobre prescripción de aines en un hospital de baja complejidad

Se analizó el efecto de dos intervenciones educativas en intervalos de seis meses sobre el uso de aines (grupo M01 según atc de 2008), medido en términos de costos totales y dosis diarias definidas (ddd)/consultas de urgencias y ambulatorias, entre enero de 2007 y junio de 2008 en el hospital San Antonio del municipio de Marmato (Caldas) en el centro de Colombia. El costo total del grupo M01 dismi- nuyó el 69,3% a diciembre de 2007 y 65,1% en junio de 2008. En ddd/consultas de urgencias y ambulatorias, el descenso fue en el primer semestre del 40,7% y en el segundo semestre del 48,5%. Naproxeno 250 mg e ibuprofeno 400 mg tabletas y diclofenaco 75 mg ampolla disminuyeron en consumos el 74,1%, 38,9% y 78,7%, respectivamente; mientras que diclofenaco 50 mg tableta incrementó el 280,0%. La sustitución en el perfil de uso de diclofenaco oral en lugar de naproxeno oral, y la disminución del uso de diclofenaco inyectable, contribuyó a la disminución del costo total. Los resultados positivos se obtuvieron por la participación y actitud favorable de todos los médicos generales del hospital hacia las reuniones de educación basadas en evidencias

Experiencias sobre el estudio de materiales alternativos para modificar asfaltos

Civil engineers generally use natural materials in order to manufacture and build structural elements, which generates a negative environmental impact. Many countries in the world are replacing natural materials by materials obtained of recycling materials products of industrial processes, construction and mining. These materials (called alternatives in this report) have been used to modify the properties of others. In Colombia, some progresses in this area have been achieved but yet further investigation is needed. In this paper a summary of some studies developed in the area of modified asphalt is presented. The aim of these studies was to evaluate the change in mechanical properties undergoing modified asphalt mixtures with additives of industrial waste products. Most of the materials used to modify the properties of asphalts and asphalt mixtures showed an increase of the mechanical strength of mixtures and the tendency of the modified asphalt is is generally to exhibit lesser thermal sensitivity, increased resistance to flow and stiffness.Por lo general, las obras de infraestructura realizadas por ingenieros civiles requieren de materiales naturales para la fabricación y construcción de elementos estructurales, lo cual genera un impacto negativo al medio ambiente Concientes de lo anterior, muchos países en el mundo se encuentran sustituyendo materiales naturales por materiales productos de reciclaje de procesos industriales, de la construcción y la minería. Estos materiales (llamados alternativos en el presente artículo) también han sido utilizados para modificar las propiedades de otros. En Colombia algunos avances en esta área se han desarrollado pero aún es necesario realizar mayor investigación. En este artículo se presentan de manera resumida los resultados de estudios desarrollados por los Grupos de Investigación de Pavimentos y Materiales de Ingeniería y Topovial en el área de los asfaltos modificados. El objetivo de las investigaciones ha sido evaluar el cambio en las propiedades mecánicas que experimentan mezclas asfálticas modificadas con aditivos productos de desechos industriales. Como conclusión general de los estudios se reporta que la mayor parte de los materiales empleados para modificar las propiedades de los asfaltos y las mezclas asfálticas aumentan la resistencia mecánica de las mezclas y la tendencia de los asfaltos modificados es presentar menor susceptibilidad térmica, mayor resistencia a fluir y rigidez.

Neuroactive Steroids in Hypoxic–Ischemic Brain Injury: Overview and Future Directions

Hypoxic–ischemic brain injury is a number one cause of long-term neurologic disability and death worldwide. This public health burden is mainly characterized by a decrease in oxygen concentration and blood flow to the tissues, which lead to an inefficient supply of nutrients to the brain. This condition induces cell death by energy depletion and increases free radical generation and inflammation. Hypoxic–ischemic brain injury may occur in ischemic-stroke and over perinatal asphyxia, being both leading causes of morbidity in adults and children, respectively. Currently, there are no effective pharmaceutical strategies to prevent the triggering of secondary injury cascades, including oxidative stress and metabolic dysfunction. Neuroactive steroids like selective estrogen receptor modulators, SERMs, and selective tissue estrogenic activity regulators, STEARs, exert several neuroprotective effects. These encompass mitochondrial survival, a decrease in reactive oxygen species, and maintenance of cell viability, among others. In this context, these neurosteroids constitute promising molecules, which could modify brain response to injury. Here we show an updated overview of the underlying mechanisms of hypoxic–ischemic brain injury. We also highlight the neuroprotective effects of neurosteroids and their future directions

Cuantificación de hidrocarburos policíclicos aromáticos urinarios en policías de tránsito del área metropolitana de bogotá

Objetivos Cuantificar niveles urinarios de 1-hidroxipireno (1-OHP) y 3-hidroxibenzo [a] pireno (3-BAP) metabolitos de hidrocarburos policíclicos aromáticos (HAP) de interés toxicológico y relacionar su detección con el grado de exposición a material particulado de tamaño menor a 10 micras (PM10) u otros factores, en una población de Policías de Tránsito ocupacionalmente expuestos en el área metropolitana de Bogotá D.C.Métodos Se realizó un estudio de corte transversal en 524 Policías de Tránsito de los cuales 413 desarrollaban funciones operativas y 111 administrativas. Se tomaron muestras de orina de todos los individuos incluidos, para la determinación de metabolitos de HAP mediante cromatografía de gases con detección de masas. Se analizó la presencia de factores asociados con la detección de los metabolitos como tabaquismo, consumo de alimentos asados, lugar de residencia y exposición a PM10. Como medida de asociación se calcularon Odds Ratio (OR).Resultados Se encontraron niveles de 1-OHP y 3-BAP superiores en los individuos expuestos con OR significativos para detección de los metabolitos de 6,3 IC 95 % (3,6-11,1) y 15,6 IC 95 % (6,2-39), respectivamente. Se hallaron OR significativos para detección de metabolitos de HAP y exposición a PM10, tabaquismo y consumo de alimentos asados.Discusión Existe una asociación importante y significativa entre la exposición laboral a contaminación ambiental y la detección de metabolitos de HAP de importancia toxicológica en muestras de orina. Factores tales como tabaquismo, consumo de alimentos asados recientemente y exposición a PM10 también se encontraron asociados positivamente con la detección de dichos metabolitos pero en menor proporción

Serum Homocysteine Levels and its Methylenetetrahydrofolate Gene (MTHFR) C677t Polymorphism in Patients with Hemodialysis

Homocysteine plays an important role in cardiovascular disease as an independent risk factor, especially in patients with renal insufficiency. The present study aimed to determine whether Hcy levels, or those of its C677T polymorphism, were associated with higher mortality in patients submitted to chronic hemodialysis treatment. This was a descriptive, prospective study. Chronic renal patients undergoing hemodialysis in the "General Hospital, ISSSTE" Dr. Darío Fernández Fierro, Mexico City were included in the study. Serum homocysteine was analyzed by means of an ELISA test. The primers utilized for MTHFR C677T polymorphism identification were the following: F: 5'TGAAGGAGAAGGTGTCTGCGGGA3', R: 5'AGGACGGTGCGGTGAGTG3' and F2: 5’GCAGGGAGCTTTGAGGCTGAC3’. Differences among nominal conditions were evaluated by the Mann-Whitney U-test. Spearman test was used for correlation among variables. Regression, log-linear analysis and receiver operating characteristic (ROC) curves were conducted to evaluate the possible influence on prognosis of Hcy levels and the presence of the MTHFR C677T polymorphism. Cox regression and Kaplan-Meier tests were performed to evaluate the Hcy levels influence on survival. In all cases, p<0.05 was considered statistically significant. All tests were performed with the SPSS ver. 23 statistical software program. By means of regression analysis (p = 0.046) and ROC curve age was the sole significant prognostic variable for the "death". The loglinear analysis did not show any association between the presence of MTHFR C677T SNP with the mortality of patients. It was concluded that Hcy levels and the presence/absence of MTHFR C677T are not stronger predictors for mortality than the traditional cardiovascular risk factors."Dr. Darío Fernández Fierro" General Hospital. Ciprés Grupo Médico S.C. (CGM)

Importancia de la Responsabilidad Social y Empresarial para el Aprovechamiento de los Residuos en la Elaboración de Estructuras Metálicas

En esta actividad final se consolida los procesos de aprendizajes que han generado en cada una de las guías de trabajo establecidas de esta forma se implementaran las estrategias dadas a conocer por los punto expuestos por la escuela de ciencias económicas y contables, en las guías y sus actividades, el grupo de trabajo 23 ha seleccionado una micro empresa, para la construcción que tiene como nombre soluciones mecánicas técnicas y diseño sas, la cual busca una mayor penetración en el mercado aprovechando la aceptación que se tiene en el medio de la construcción generando métodos innovadores en el área de estructuras metálicas con el fin de generar cumplimiento en los procesos y normas que hacen referencia a la responsabilidad social y empresarial. Ahora bien, esto permite tener en conocimiento exacto que se requiere para la elaboración de un proyecto que cumpla con las características idóneas requeridas para presentar este trabajo con proyecto final de graduación, es importante destacar que cada una de las actividades desarrolladas permitió el consolidado éxito de la actividad unidad 9 y 10 fase 5. Desde el principio del diplomado se buscó en consolidado de los ítems que hacen referente a la responsabilidad social y empresarial.In this final activity, the learning processes that have been generated in each of the established work guides are consolidated. In this way, the strategies made known by the points presented by the national open and distance university in the activity guides will be implemented, the working group 23 has selected a micro company, for construction whose name is technical mechanical solutions and design sas, which seeks greater penetration in the market taking advantage of the acceptance that exists in the construction environment, generating innovative methods in the area of metal structures in order to generate compliance in the processes and standards that refer to social and business responsibility. Now, this allows us to have exact knowledge of what is required for the development of a project that meets the ideal characteristics required to present this work with a final graduation project. It is important to highlight that each of the activities developed allowed the consolidated success of the activity unit 9 and 10 phase 5. From the beginning of the diploma, a consolidated search was made for the items that refer to social and business responsibility