Developing Single-Molecule TPM Experiments for Direct Observation of Successful RecA-Mediated Strand Exchange Reaction

RecA recombinases play a central role in homologous recombination. Once assembled on single-stranded (ss) DNA, RecA nucleoprotein filaments mediate the pairing of homologous DNA sequences and strand exchange processes. We have designed two experiments based on tethered particle motion (TPM) to investigate the fates of the invading and the outgoing strands during E. coli RecA-mediated pairing and strand exchange at the single-molecule level in the absence of force. TPM experiments measure the tethered bead Brownian motion indicative of the DNA tether length change resulting from RecA binding and dissociation. Experiments with beads labeled on either the invading strand or the outgoing strand showed that DNA pairing and strand exchange occurs successfully in the presence of either ATP or its non-hydrolyzable analog, ATPγS. The strand exchange rates and efficiencies are similar under both ATP and ATPγS conditions. In addition, the Brownian motion time-courses suggest that the strand exchange process progresses uni-directionally in the 5′-to-3′ fashion, using a synapse segment with a wide and continuous size distribution

RecA homology search is promoted by mechanical stress along the scanned duplex DNA

A RecA–single-stranded DNA (RecA–ssDNA) filament searches a genome for sequence homology by rapidly binding and unbinding double-stranded DNA (dsDNA) until homology is found. We demonstrate that pulling on the opposite termini (3′ and 5′) of one of the two DNA strands in a dsDNA molecule stabilizes the normally unstable binding of that dsDNA to non-homologous RecA–ssDNA filaments, whereas pulling on the two 3′, the two 5′, or all four termini does not. We propose that the ‘outgoing’ strand in the dsDNA is extended by strong DNA–protein contacts, whereas the ‘complementary’ strand is extended by the tension on the base pairs that connect the ‘complementary’ strand to the ‘outgoing’ strand. The stress resulting from different levels of tension on its constitutive strands causes rapid dsDNA unbinding unless sufficient homology is present

Fluorescence-detected interactions of oligonucleotides in RecA complexes

AbstractA technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA. The 24-mer oligonucleotide 5′-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATPγS, binding of two oligonuclotides, identical or complementary in sequence, in the RecA filament is possible. The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed. In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changed, and we now find protein-mediated renaturation to occur

Dynamics of RecA filaments on single-stranded DNA

RecA, the key protein in homologous recombination, performs its actions as a helical filament on single-stranded DNA (ssDNA). ATP hydrolysis makes the RecA–ssDNA filament dynamic and is essential for successful recombination. RecA has been studied extensively by single-molecule techniques on double-stranded DNA (dsDNA). Here we directly probe the structure and kinetics of RecA interaction with its biologically most relevant substrate, long ssDNA molecules. We find that RecA ATPase activity is required for the formation of long continuous filaments on ssDNA. These filaments both nucleate and extend with a multimeric unit as indicated by the Hill coefficient of 5.4 for filament nucleation. Disassembly rates of RecA from ssDNA decrease with applied stretching force, corresponding to a mechanism where protein-induced stretching of the ssDNA aids in the disassembly. Finally, we show that RecA–ssDNA filaments can reversibly interconvert between an extended, ATP-bound, and a compressed, ADP-bound state. Taken together, our results demonstrate that ATP hydrolysis has a major influence on the structure and state of RecA filaments on ssDNA

Crystal structure of the left-handed archaeal RadA helical filament: identification of a functional motif for controlling quaternary structures and enzymatic functions of RecA family proteins

The RecA family of proteins mediates homologous recombination, an evolutionarily conserved pathway that maintains genomic stability by protecting against DNA double strand breaks. RecA proteins are thought to facilitate DNA strand exchange reactions as closed-rings or as right-handed helical filaments. Here, we report the crystal structure of a left-handed Sulfolobus solfataricus RadA helical filament. Each protomer in this left-handed filament is linked to its neighbour via interactions of a β-strand polymerization motif with the neighbouring ATPase domain. Immediately following the polymerization motif, we identified an evolutionarily conserved hinge region (a subunit rotation motif) in which a 360° clockwise axial rotation accompanies stepwise structural transitions from a closed ring to the AMP–PNP right-handed filament, then to an overwound right-handed filament and finally to the left-handed filament. Additional structural and functional analyses of wild-type and mutant proteins confirmed that the subunit rotation motif is crucial for enzymatic functions of RecA family proteins. These observations support the hypothesis that RecA family protein filaments may function as rotary motors

The process of displacing the single-stranded DNA-binding protein from single-stranded DNA by RecO and RecR proteins

The regions of single-stranded (ss) DNA that result from DNA damage are immediately coated by the ssDNA-binding protein (SSB). RecF pathway proteins facilitate the displacement of SSB from ssDNA, allowing the RecA protein to form protein filaments on the ssDNA region, which facilitates the process of recombinational DNA repair. In this study, we examined the mechanism of SSB displacement from ssDNA using purified Thermus thermophilus RecF pathway proteins. To date, RecO and RecR are thought to act as the RecOR complex. However, our results indicate that RecO and RecR have distinct functions. We found that RecR binds both RecF and RecO, and that RecO binds RecR, SSB and ssDNA. The electron microscopic studies indicated that SSB is displaced from ssDNA by RecO. In addition, pull-down assays indicated that the displaced SSB still remains indirectly attached to ssDNA through its interaction with RecO in the RecO-ssDNA complex. In the presence of both SSB and RecO, the ssDNA-dependent ATPase activity of RecA was inhibited, but was restored by the addition of RecR. Interestingly, the interaction of RecR with RecO affected the ssDNA-binding properties of RecO. These results suggest a model of SSB displacement from the ssDNA by RecF pathway proteins

Evaluation of glyceraldehyde-3-phosphate, prolylpeptidyl isomerase A, and a set of stably expressed genes as reference mRNAs in urate crystal inflammation

ABSTRACT

Modeling the early stage of DNA sequence recognition within RecA nucleoprotein filaments

Homologous recombination is a fundamental process enabling the repair of double-strand breaks with a high degree of fidelity. In prokaryotes, it is carried out by RecA nucleofilaments formed on single-stranded DNA (ssDNA). These filaments incorporate genomic sequences that are homologous to the ssDNA and exchange the homologous strands. Due to the highly dynamic character of this process and its rapid propagation along the filament, the sequence recognition and strand exchange mechanism remains unknown at the structural level. The recently published structure of the RecA/DNA filament active for recombination (Chen et al., Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structure, Nature 2008, 453, 489) provides a starting point for new exploration of the system. Here, we investigate the possible geometries of association of the early encounter complex between RecA/ssDNA filament and double-stranded DNA (dsDNA). Due to the huge size of the system and its dense packing, we use a reduced representation for protein and DNA together with state-of-the-art molecular modeling methods, including systematic docking and virtual reality simulations. The results indicate that it is possible for the double-stranded DNA to access the RecA-bound ssDNA while initially retaining its Watson–Crick pairing. They emphasize the importance of RecA L2 loop mobility for both recognition and strand exchange

Insights into the mechanism of Rad51 recombinase from the structure and properties of a filament interface mutant

Rad51 protein promotes homologous recombination in eukaryotes. Recombination activities are activated by Rad51 filament assembly on ssDNA. Previous studies of yeast Rad51 showed that His352 occupies an important position at the filament interface, where it could relay signals between subunits and active sites. To investigate, we characterized yeast Rad51 H352A and H352Y mutants, and solved the structure of H352Y. H352A forms catalytically competent but salt-labile complexes on ssDNA. In contrast, H352Y forms salt-resistant complexes on ssDNA, but is defective in nucleotide exchange, RPA displacement and strand exchange with full-length DNA substrates. The 2.5 Å crystal structure of H352Y reveals a right-handed helical filament in a high-pitch (130 Å) conformation with P61 symmetry. The catalytic core and dimer interface regions of H352Y closely resemble those of DNA-bound Escherichia coli RecA protein. The H352Y mutation stabilizes Phe187 from the adjacent subunit in a position that interferes with the γ-phosphate-binding site of the Walker A motif/P-loop, potentially explaining the limited catalysis observed. Comparison of Rad51 H352Y, RecA–DNA and related structures reveals that the presence of bound DNA correlates with the isomerization of a conserved cis peptide near Walker B to the trans configuration, which appears to prime the catalytic glutamate residue for ATP hydrolysis

Loop 2 in Saccharomyces cerevisiae Rad51 protein regulates filament formation and ATPase activity

Previous studies showed that the K342E substitution in the Saccharomyces cerevisiae Rad51 protein increases the interaction with Rad54 protein in the two-hybrid system, leads to increased sensitivity to the alkylating agent MMS and hyper-recombination in an oligonucleotide-mediated gene targeting assay. K342 localizes in loop 2, a region of Rad51 whose function is not well understood. Here, we show that Rad51-K342E displays DNA-independent and DNA-dependent ATPase activities, owing to its ability to form filaments in the absence of a DNA lattice. These filaments exhibit a compressed pitch of 81 Å, whereas filaments of wild-type Rad51 and Rad51-K342E on DNA form extended filaments with a 97 Å pitch. Rad51-K342E shows near normal binding to ssDNA, but displays a defect in dsDNA binding, resulting in less stable protein-dsDNA complexes. The mutant protein is capable of catalyzing the DNA strand exchange reaction and is insensitive to inhibition by the early addition of dsDNA. Wild-type Rad51 protein is inhibited under such conditions, because of its ability to bind dsDNA. No significant changes in the interaction between Rad51-K342E and Rad54 could be identified. These findings suggest that loop 2 contributes to the primary DNA-binding site in Rad51, controlling filament formation and ATPase activity