The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

A new limit on the Ultra-High-Energy Cosmic-Ray flux with the Westerbork Synthesis Radio Telescope

A particle cascade (shower) in a dielectric, for example as initiated by an ultra-high energy cosmic ray, will have an excess of electrons which will emit coherent \v{C}erenkov radiation, known as the Askaryan effect. In this work we study the case in which such a particle shower occurs in a medium just below its surface. We show, for the first time, that the radiation transmitted through the surface is independent of the depth of the shower below the surface when observed from far away, apart from trivial absorption effects. As a direct application we use the recent results of the NuMoon project, where a limit on the neutrino flux for energies above $10^{22}$\,eV was set using the Westerbork Synthesis Radio Telescope by measuring pulsed radio emission from the Moon, to set a limit on the flux of ultra-high-energy cosmic rays.Comment: Accepted for publication in Phys. Rev.

Actors and factors - bridging social science findings and urban land use change modeling

Recent uneven land use dynamics in urban areas resulting from demographic change, economic pressure and the cities’ mutual competition in a globalising world challenge both scientists and practitioners, among them social scientists, modellers and spatial planners. Processes of growth and decline specifically affect the urban environment, the requirements of the residents on social and natural resources. Social and environmental research is interested in a better understanding and ways of explaining the interactions between society and landscape in urban areas. And it is also needed for making life in cities attractive, secure and affordable within or despite of uneven dynamics.\ud The position paper upon “Actors and factors – bridging social science findings and urban land use change modeling” presents approaches and ideas on how social science findings on the interaction of the social system (actors) and the land use (factors) are taken up and formalised using modelling and gaming techniques. It should be understood as a first sketch compiling major challenges and proposing exemplary solutions in the field of interest

Superheating and solid-liquid phase coexistence in nanoparticles with non-melting surfaces

We present a phenomenological model of melting in nanoparticles with facets that are only partially wet by their liquid phase. We show that in this model, as the solid nanoparticle seeks to avoid coexistence with the liquid, the microcanonical melting temperature can exceed the bulk melting point, and that the onset of coexistence is a first-order transition. We show that these results are consistent with molecular dynamics simulations of aluminum nanoparticles which remain solid above the bulk melting temperature.Comment: 8 pages, 5 figure

An air shower array for LOFAR: LORA

LOFAR is a new form of radio telescope which can detect radio emission from air showers induced by very high-energy cosmic rays. It can also look for radio emission from particle cascades on the Moon induced by ultra high-energy cosmic rays or neutrinos. To complement the radio detection, we are setting up a small particle detector array LORA (LOfar Radboud Air shower array) within an area of $\sim 300$ m diameter in the LOFAR core. It will help in triggering and confirming the radio detection of air showers with the LOFAR antennas. In this paper, we present a short overview about LORA and discuss its current status.Comment: 10 pages (using article.cls), 6 figures, accepted for the proceedings of 22nd European Cosmic Ray Symposium, 3-6 August 2010, Finlan

Results from a Near Infrared Search for Emission-line Stars in the Inner Galaxy: Spectra of New Wolf-Rayet Stars

We present follow-up spectroscopy of emission line candidates detected on near-infrared narrow band images in the inner Galaxy (Homeier et al. 2003). The filters are optimized for the detection of Wolf-Rayet stars and other objects which exhibit emission--lines in the 2 $\mu$m region. Approximately three square degrees along the Galactic plane have been analyzed in seven narrow--filters (four emission--lines and three continuum). We have discovered 4 new Wolf-Rayet stars and present coordinates, finding charts, and K-band spectra.Comment: To appear in Astronomy & Astrophysic

The Anomalous Infrared Emission of Abell 58

We present a new model to explain the excess in mid and near infrared emission of the central, hydrogen poor dust knot in the planetary nebula (PN) Abell 58. Current models disagree with ISO measurement because they apply an average grain size and equilibrium conditions only. We investigate grain size distributions and temperature fluctuations affecting infrared emission using a new radiative transfer code and discuss in detail the conditions requiring an extension of the classical description. The peculiar infrared emission of V605 Aql, the central dust knot in Abell 58, has been modeled with our code. V605 Aql is of special interest as it is one of only three stars ever observed to move from the evolutionary track of a central PN star back to the post-AGB state.Comment: 17 pages, 4 figures; accepted and to be published in Ap

Mid-IR period-magnitude relations for AGB stars

Asymptotic Giant Branch variables are found to obey period-luminosity relations in the mid-IR similar to those seen at K_S (2.14 microns), even at 24 microns where emission from circumstellar dust is expected to be dominant. Their loci in the M, logP diagrams are essentially the same for the LMC and for NGC6522 in spite of different ages and metallicities. There is no systematic trend of slope with wavelength. The offsets of the apparent magnitude vs. logP relations imply a difference between the two fields of 3.8 in distance modulus. The colours of the variables confirm that a principal period with log P > 1.75 is a necessary condition for detectable mass-loss. At the longest observed wavelength, 24 microns, many semi-regular variables have dust shells comparable in luminosity to those around Miras. There is a clear bifurcation in LMC colour-magnitude diagrams involving 24 micron magnitudes.Comment: 5 pages, 4 figure

The patient safety practices of emergency medical teams in disaster zones: a systematic analysis

Introduction: Disaster zone medical relief has been criticised for poor quality care, lack of standardisation and accountability. Traditional patient safety practices of Emergency Medical Teams (EMT) in disaster zones were not well understood. Improving the quality of healthcare in disaster zones has gained importance within global health policy. Ascertaining patient safety practices of EMTs in disaster zones may identify areas of practice that can be improved. Methods: A systematic search of OvidSP, Embase and Medline databases, key journals of interest, key grey-literature texts, the databases of the World Health Organisation (WHO), Médecins Sans Frontieres (MSF) and the International Committee of the Red Cross (ICRC), and Google Scholar were performed. Descriptive studies, case reports, case series, prospective trials and opinion pieces were included with no limitation on date or language of publication. Results: There were 9,685 records, evenly distributed between the peer-reviewed and grey literature. Of these, 30 studies and 9 grey literature texts met the inclusion criteria and underwent qualitative synthesis. From these articles, 302 patient safety statements were extracted. Thematic analysis categorised these statements into 84 themes (total frequency 632). The most frequent themes were limb injury (9%), medical records (5.4%), surgery decision making (4.6%), medicines safety (4.4%) and protocol (4.4%) Conclusion: Patient safety practices of EMTs in disaster zones are weighted towards acute clinical care, particularly surgery. The management of Non-Communicable Disease (NCD) is underrepresented. There is widespread recognition of the need to improve medical record keeping. High-quality data and institutional level patient safety practices are lacking. There is no consensus on disaster zone specific performance indicators. These deficiencies represent opportunities to improve patient safety in disaster zones

Identification of Very Red Counterparts of SiO Maser and OH/IR Objects in the GLIMPSE Survey

Using the 3.6/4.5/5.8/8.0 micron images with 1.2 arcsec pixel resolution from the Spitzer/GLIMPSE survey, we investigated 23 masing and 18 very red objects that were not identified in the 2MASS survey. Counterparts for all selected objects were found in the GLIMPSE images. Color indices in these IR bands suggest the presence of a high-extinction layer of more than a few tenths of a solar mass in front of the central star. Furthermore, radio observations in the SiO and H2O maser lines found characteristic maser-line spectra of the embedded objects, e.g., the SiO J=1-0 line intensity in the v=2 state stronger than that of the v=1 state, or very widespread H2O maser emission spectra. This indicates that these objects are actually enshrouded by very thick circumstellar matter, some of which cannot be ascribed to the AGB wind of the central star. Individually interesting objects are discussed, including two newly found water fountains and an SiO source with nebulosity.Comment: High resolution figures available at ftp://ftp.nro.nao.ac.jp/nroreport/no653.pdf.gz. ApJ No. 655 no.1 issue in pres