Evaluación de la activación de linfocitos de ratas desnutridas durante la lactancia

La desnutrición está ampliamente distribuida en el mundo y es un problema en países en desarrollo. Los estragos en los niños pueden ser devastadores. En la actualidad se reconoce que aproximadamente 10 millones de niños menores de 5 años mueren cada año en países en desarrollo, de las cuales más del 50% se puede atribuir a enfermedades prevenibles: la desnutrición contribuye a estas muertes. El objetivo general de este estudio fue evaluar la activación in vitro de linfocitos de bazo y la proliferación in vivo de células de bazo de ratas con desnutrición de segundo y tercer grado inducida experimentalmente por competencia de alimento durante la lactancia a los 21 días de edad y compararlo con ratas bien nutridas. Para esto se cuantificaron, por medio de citometría de flujo, el porcentaje de los linfocitos T, B, NK y, dentro de los T, los T4 y T8 en ratas desnutridas de segundo y tercer grado y testigos bien nutridos, obtenidos a partir de sangre periférica y los extraídos del bazo. Se determinó, por citometría de flujo, el efecto de ambos grados de desnutrición sobre la activación de linfocitos de bazo de ratas desnutridas de segundo y tercer grado y testigos sanos en cultivos primarios in vitro. Se determinó el efecto de la desnutrición sobre la proliferación in vivo de células de bazo de ratas de 21 días de edad. Se indujo la desnutrición durante la lactancia y al final de esta, se clasificaron en tres grados, según el déficit de peso: primer grado o leve (déficit mayor al 10% y menor a 25); segundo grado o moderada (déficit de 25% y menor de 40%); tercer grado o grave (déficit de 40% o más). Se estudiaron los grupos de ratas con desnutrición moderada y grave. Los resultados mostraron que ambos grupos de ratas desnutridas tienen una cantidad menor de leucocitos, monocitos y linfocitos en sangre periférica, en comparación con las ratas testigo. Se observó que de los linfocitos T la subpoblación afectada fue la CD4+ (cooperadores) en sangre y en bazo, lo cual repercutió en la población de linfocitos T. La activación de los linfocitos de bazo en cultivo se evaluó estimulándolos con el mitógeno fitohemaglutinina (PHA). La respuesta se midió determinando el incremento en la expresión de los marcadores CD71 y CD25, que se expresan al estimular a los linfocitos T con la PHA, o con un antígeno. La proporción de linfocitos CD3+CD71+ y de CD3+CD25+ (activados) de ambos grupos de ratas desnutridas fue menor que la de ratas bien nutridas (p < 0.05). Además, se observó una correlación positiva entre el peso del bazo y el porcentaje de células que expresaron el receptor CD71 (R=0.97). No se observó diferencia significativa entre las ratas desnutridas de segundo y tercer grado. La proliferación de las células de bazo se determinó administrando bromodesoxiuridina (BrdU) y su incorporación se detectó con anticuerpos monoclonales anti-BrdU, conjugados con fluoresceína (FITC), el contenido de ADN total por yoduro de propidio y se evaluaron por citometría de flujo. La proporción de células en fase G1 fue mayor en las ratas desnutridas que en las bien nutridas, pero no se observó diferencia entre ratas con desnutrición moderada y grave. La proporción de células en la fase S fue mayor en las ratas bien nutridas, que en las desnutridas. La proporción de células en fase la G2/M fue menor en ambos grupos de ratas desnutridas que la del grupo de las bien nutridas. El índice de incorporación de BrdU (LI) fue menor en las células de bazo de ratas desnutridas, la duración de la fase S (TS) no mostró diferencia significativa entre los grupos y el tiempo de duplicación de la población celular (Tpot) se incrementó en ambos grupos de de ratas desnutridas. Los resultados muestran que la desnutrición moderada tiene efectos tan importantes como la desnutrición grave, que involucraron la proporción de linfocitos en sangre y bazo, la activación de linfocitos y la proliferación celular en bazo. Los resultados son una evidencia por la que, en parte, se puede explicar la susceptibilidad a infecciones asociada a la desnutrición.Malnutrition is distributed widely throughout the World and is a particular problem in developing countries. Actually, recent studies estimate that 10 million of children younger than 5 years of age die in developing countries; more than 50% of deaths in children are attributed to conditions preventable: the malnutrition contributes to these deaths. The objective of the present study was to evaluate the activation of spleen lymphocytes in vitro and proliferation of spleen cells in vivo of rats with moderate and severe malnutrition experimentally induced during lactation period compared with well-nourished rats. The percentage of T, B, NK cells and in T lymphocytes, T4 and T8 were determinate in malnourished rats of moderate and severe level and control rats, obtained of peripheral blood and spleen, assessed by flow cytometry. The effect of both levels of malnutrition on activation of splenic T cells in vitro of malnourished rats of second and third degree, assessed by flow cytometry. It was analyzed the effect of malnutrition on cell proliferation on splenic cells of suckling rats in vivo. The malnutrition was induced during the lactation period until weaning. The degree of malnutrition was established according to the classification used for children: the number was categorized as mild or first degree when the weight deficit reached 10– 25%; moderate or second degree (MN2nd) when the weight deficit reached 25–40%; and severe or third degree (MN3rd) when the weight deficit was greater than 40% of that of age-matched control rats (WN). The moderate and severe malnourished rats were studied. The results showed that both malnourished groups of rats have lower numbers of leukocytes, monocytes and lymphocytes on peripheral blood. The CD4+ lymphocytes subpopulation was affected on blood and spleen. Response to mitogen stimuli of phytohaemagglutinin (PHA) was evaluated in splenic lymphocytes. Expression of cell surface activation markers CD71+ and CD25+ was evaluated, to determinate the response of T cells. Both groups of malnourished rats showed a significant decrease in the percentage of CD3+CD71+ and CD3+CD25+ cells at 24 h post-activation with PHA. There was a positive correlation between spleen weight and the percentages of spleen cells expressing CD71 (R = 0.97) receptors. No significant difference was observed between the moderate and severe malnourished rats. Cell proliferation was studied by detection of BrdU incorporation and flow cytometry. The method involves calculation using flow cytometry data of BrdU incorporation (green fluorescence, FITC-labelled anti-BrdU-DNA antibody) and total DNA content (red fluorescence, propidium iodide). After 21 days of age, BrdU at the dose of 1 mg/g body weight was administered by intraperitoneal injection. Flow cytometry was used to detect BrdU labeling in proliferating splenocytes. Distribution of cells in each cycle cells was analyzed. The proportion of cells in G1 phase was higher in malnourished rats than well-nourished rats, but no significant difference was observed between the moderate and severe malnourished rats, but no significative difference was observed in borh malnourished groups. No significant difference was observed in proportion of cells in S phase between well-nourished and malnourished rats. Percentage of G2/M was lower in both groups of malnourished rats. The labelling index of BrdU+ (LI), Sphase duration (TS) and potential doubling time (Tpot) were calculated. The LI of cells was lower in both groups of malnourished rats than WN rats. The obtained TS was not different in both malnourished rats to WN rats. Tpot was significantly higher in both malnourished groups. In conclusion, the results of this study suggest that moderate malnutrition is as bad as severe malnutrition with effects in different parameters of immune system: lymphocytes proportion of blood and spleen, lymphocyte activation and cell proliferation in spleen. The data explain, in part, the increased susceptibility increased associated with malnutrition

Personas mayores: ¿sujetos de bienestar y derechos?

El envejecimiento de las Personas Mayores se ha instaurado como un tema de preocupación en las ciencias sociales y humanas. No obstante ello, el maltrato y la violencia hacia este grupo etario se presenta como uno de los menos abordados en las investigaciones en distintos campos académicos. Atendiendo a este diagnóstico, en esta ponencia nos proponemos realizar una aproximación antropológica al estudio de este tema, con el objetivo de transferir conocimientos y experiencias para promover el bienestar y los derechos de las Personas Mayores. Los antecedentes de este trabajo remiten a un Proyecto de Extensión Universitaria, que se viene desarrollando de manera ininterrumpida desde el año 2016 y a los diferentes Proyectos, Pasantías y Becas de investigación llevadas a cabo por los integrantes del Laboratorio de Etnografía Aplicada (FCNyM - UNLP). La propuesta combina la metodología participativa en territorio y trabajo de laboratorio. Los encuentros con las Personas Mayores se desarrollarán bajo la modalidad de foros participativos-presenciales y/o virtuales, además de talleres grupales. Los resultados obtenidos apuestan identificar las demandas propias de estas poblaciones; fomentar la integración desde el reconocimiento de su participación política y autonomía; motivar el conocimiento y reconocimiento de cuestiones relativas al bienestar y los derechos de las Personas Mayores, entre otros grupos generacionales. Así generar recursos humanos y materiales, que podrán ser utilizados como insumos en programas de prevención y promoción del Bienestar y los Derechos de las Personas Mayores, que coordina la Defensoría del Pueblo.GT08: Cultura y envejecimiento. El qué-hacer antropológico y gerontológico en el abordaje de las trayectorias vitales.Universidad Nacional de La Plat

Metodología de desarrollo evolutivo de escenarios tridimensionales para la creación de una visita virtual para el Centro Universitario UAEM Ecatepec

Actualmente, uno de los medios de comunicación claves para acceder al público en general es el uso de las tecnologías de información y comunicación dentro de las cuales se encuentra la Realidad Virtual, que ha sido utilizada para desarrollar entornos virtuales como una alternativa novedosa de difusión a través de la Web. Es por ello, que en esta investigación se propone y se aplica una metodología para el desarrollo de escenarios tridimensionales para la creación de una visita virtual: caso Centro Universitario UAEM Ecatepec. Esta metodología con características evolutivas permite la eliminación de errores y alternativas no atractivas al comienzo del proyecto; la entrega de productos intermedios operacionales que se pueden ir refinando en cada iteración; logrando de esta manera, crear visitas virtuales de una forma organizada en lapsos de tiempo estimado, manteniendo colaboración y tomando en cuenta los puntos de vista de los integrantes del proyecto, el cliente y/o usuarios

Factores relacionados con los resultados de la práctica médica en el área gineco-obstetricia en casos de trascendencia legal durante 1998 y 1999

Determina los factores que entran en juego en los resultados de la práctica médica en el paí

MANIFESTACIONES SOCIALES TRANSGRESORAS DEL DERECHO DE AUTONOMÍA EN RELACIÓN CON LA COMUNIDAD LGTB

The objective of this article is to reflect on the transgressive social manifestations of the right of autonomy in relation to the LGBT community. It is transcendental to look at this type of social behavior with incidents in the law and through this thorough analysis know the management of these relationships, delving into their future to determine if there are manifestations that account for behaviors with homophobic, abuse and discrimination. &nbsp;El objetivo del presente artículo es reflexionar acerca de las manifestaciones sociales trasgresoras del Derecho de autonomía con relación a la comunidad LGTB. Es transcendental dirigir la mirada a este tipo de comportamiento sociales con incidencias en el derecho y a través de este análisis concienzudo conocer el manejo de estas relaciones, ahondando en su devenir para determinar si existen manifestaciones que den cuenta de conductas con señales homofóbicas, de abuso y discriminación

“New” metastases are associated with a poorer prognosis than growth of pre-existing metastases in patients with metastatic breast cancer treated with chemotherapy

Introduction: Progression-free survival (PFS) and overall survival (OS) endpoints often only weakly correlate. This analysis investigates how different progression events impact on OS, using data from two phase 3 studies with eribulin in women with advanced/metastatic breast cancer (MBC). Methods: In Study 301, 1102 women with ≤2 prior chemotherapies for advanced/MBC were randomized to eribulin mesylate (1.4 mg/m2 on days 1 and 8 every 21 days) or capecitabine (1.25 g/m2 twice daily on days 1-14 every 21 days). Study 305/EMBRACE enrolled 762 patients following two to five prior chemotherapies for advanced/MBC, randomized to eribulin (as above) or treatment of physician's choice. We analyzed OS and PFS post hoc for patients whose disease progressed due to development of "new" metastases, growth of pre-existing lesions, and patients with no reported disease progression. Results: In both clinical studies, development of new metastases was associated with an increased risk of death (p < 0.0001). The time to development of new metastasis or death was significantly longer with eribulin than the comparator in Study 305 (p = 0.0017), but not in Study 301 (p = 0.46). Significantly longer OS was observed in the eribulin compared with the comparator arm for the new metastases subgroup in Study 301 (p = 0.008), but not in Study 305 (p = 0.16), compared with other progression subgroups. Conclusions: Patients with MBC progressing with new metastases have a worse prognosis than those whose disease progresses due to growth of existing lesions or patients with no reported disease progression. These findings have potentially important implications for the interpretation of clinical study data and clinical practice.SCOPUS: ar.jinfo:eu-repo/semantics/publishe

Fanconi anemia cells with unrepaired DNA damage activate components of the checkpoint recovery process

International audienceBACKGROUND:The FA/BRCA pathway repairs DNA interstrand crosslinks. Mutations in this pathway cause Fanconi anemia (FA), a chromosome instability syndrome with bone marrow failure and cancer predisposition. Upon DNA damage, normal and FA cells inhibit the cell cycle progression, until the G2/M checkpoint is turned off by the checkpoint recovery, which becomes activated when the DNA damage has been repaired. Interestingly, highly damaged FA cells seem to override the G2/M checkpoint. In this study we explored with a Boolean network model and key experiments whether checkpoint recovery activation occurs in FA cells with extensive unrepaired DNA damage.METHODS:We performed synchronous/asynchronous simulations of the FA/BRCA pathway Boolean network model. FA-A and normal lymphoblastoid cell lines were used to study checkpoint and checkpoint recovery activation after DNA damage induction. The experimental approach included flow cytometry cell cycle analysis, cell division tracking, chromosome aberration analysis and gene expression analysis through qRT-PCR and western blot.RESULTS:Computational simulations suggested that in FA mutants checkpoint recovery activity inhibits the checkpoint components despite unrepaired DNA damage, a behavior that we did not observed in wild-type simulations. This result implies that FA cells would eventually reenter the cell cycle after a DNA damage induced G2/M checkpoint arrest, but before the damage has been fixed. We observed that FA-A cells activate the G2/M checkpoint and arrest in G2 phase, but eventually reach mitosis and divide with unrepaired DNA damage, thus resolving the initial checkpoint arrest. Based on our model result we look for ectopic activity of checkpoint recovery components. We found that checkpoint recovery components, such as PLK1, are expressed to a similar extent as normal undamaged cells do, even though FA-A cells harbor highly damaged DNA.CONCLUSIONS:Our results show that FA cells, despite extensive DNA damage, do not loss the capacity to express the transcriptional and protein components of checkpoint recovery that might eventually allow their division with unrepaired DNA damage. This might allow cell survival but increases the genomic instability inherent to FA individuals and promotes cancer

ANTOLOGÍA DE TEXTOS PARA LA UNIDAD DE APRENDIZAJE: ESTUDIOS FUNCIONALISTAS DE LA COMUNICACIÓN

ANTOLOGÍ

Serum Homocysteine Levels and its Methylenetetrahydrofolate Gene (MTHFR) C677t Polymorphism in Patients with Hemodialysis

Homocysteine plays an important role in cardiovascular disease as an independent risk factor, especially in patients with renal insufficiency. The present study aimed to determine whether Hcy levels, or those of its C677T polymorphism, were associated with higher mortality in patients submitted to chronic hemodialysis treatment. This was a descriptive, prospective study. Chronic renal patients undergoing hemodialysis in the "General Hospital, ISSSTE" Dr. Darío Fernández Fierro, Mexico City were included in the study. Serum homocysteine was analyzed by means of an ELISA test. The primers utilized for MTHFR C677T polymorphism identification were the following: F: 5'TGAAGGAGAAGGTGTCTGCGGGA3', R: 5'AGGACGGTGCGGTGAGTG3' and F2: 5’GCAGGGAGCTTTGAGGCTGAC3’. Differences among nominal conditions were evaluated by the Mann-Whitney U-test. Spearman test was used for correlation among variables. Regression, log-linear analysis and receiver operating characteristic (ROC) curves were conducted to evaluate the possible influence on prognosis of Hcy levels and the presence of the MTHFR C677T polymorphism. Cox regression and Kaplan-Meier tests were performed to evaluate the Hcy levels influence on survival. In all cases, p<0.05 was considered statistically significant. All tests were performed with the SPSS ver. 23 statistical software program. By means of regression analysis (p = 0.046) and ROC curve age was the sole significant prognostic variable for the "death". The loglinear analysis did not show any association between the presence of MTHFR C677T SNP with the mortality of patients. It was concluded that Hcy levels and the presence/absence of MTHFR C677T are not stronger predictors for mortality than the traditional cardiovascular risk factors."Dr. Darío Fernández Fierro" General Hospital. Ciprés Grupo Médico S.C. (CGM)

Muscle Expression of Mutant Androgen Receptor Accounts for Systemic and Motor Neuron Disease Phenotypes in Spinal and Bulbar Muscular Atrophy

SummaryX-linked spinal and bulbar muscular atrophy (SBMA) is characterized by adult-onset muscle weakness and lower motor neuron degeneration. SBMA is caused by CAG-polyglutamine (polyQ) repeat expansions in the androgen receptor (AR) gene. Pathological findings include motor neuron loss, with polyQ-AR accumulation in intranuclear inclusions. SBMA patients exhibit myopathic features, suggesting a role for muscle in disease pathogenesis. To determine the contribution of muscle, we developed a BAC mouse model featuring a floxed first exon to permit cell-type-specific excision of human AR121Q. BAC fxAR121 mice develop systemic and neuromuscular phenotypes, including shortened survival. After validating termination of AR121 expression and full rescue with ubiquitous Cre, we crossed BAC fxAR121 mice with Human Skeletal Actin-Cre mice. Muscle-specific excision prevented weight loss, motor phenotypes, muscle pathology, and motor neuronopathy and dramatically extended survival. Our results reveal a crucial role for muscle expression of polyQ-AR in SBMA and suggest muscle-directed therapies as effective treatments