Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology

<p>Abstract</p> <p>Background</p> <p>Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine <it>PRNP</it> (b<it>PRNP</it>) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down b<it>PRNP</it> were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of <it>PRNP</it>, and lengths of siRNAs.</p> <p>Results</p> <p>Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNA^Valpromoter. Six target sites of bovine <it>PRNP </it>were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire b<it>PRNP </it>coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or <it>Renilla </it>luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a <it>Bsp </it>MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.</p> <p>Conclusion</p> <p>Four siRNA expression plasmid vectors, six target sites of b<it>PRNP</it>, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of b<it>PRNP </it>in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.</p

Proteomics-Based Systems Biology Modeling of Bovine Germinal Vesicle Stage Oocyte and Cumulus Cell Interaction

BACKGROUND: Oocytes are the female gametes which establish the program of life after fertilization. Interactions between oocyte and the surrounding cumulus cells at germinal vesicle (GV) stage are considered essential for proper maturation or 'programming' of oocytes, which is crucial for normal fertilization and embryonic development. However, despite its importance, little is known about the molecular events and pathways involved in this bidirectional communication. METHODOLOGY/PRINCIPAL FINDINGS: We used differential detergent fractionation multidimensional protein identification technology (DDF-Mud PIT) on bovine GV oocyte and cumulus cells and identified 811 and 1247 proteins in GV oocyte and cumulus cells, respectively; 371 proteins were significantly differentially expressed between each cell type. Systems biology modeling, which included Gene Ontology (GO) and canonical genetic pathway analysis, showed that cumulus cells have higher expression of proteins involved in cell communication, generation of precursor metabolites and energy, as well as transport than GV oocytes. Our data also suggests a hypothesis that oocytes may depend on the presence of cumulus cells to generate specific cellular signals to coordinate their growth and maturation. CONCLUSIONS/SIGNIFICANCE: Systems biology modeling of bovine oocytes and cumulus cells in the context of GO and protein interaction networks identified the signaling pathways associated with the proteins involved in cell-to-cell signaling biological process that may have implications in oocyte competence and maturation. This first comprehensive systems biology modeling of bovine oocytes and cumulus cell proteomes not only provides a foundation for signaling and cell physiology at the GV stage of oocyte development, but are also valuable for comparative studies of other stages of oocyte development at the molecular level

The effect of peri-conception hyperglycaemia and the involvement of the hexosamine biosynthesis pathway in mediating oocyte and embryo developmental competence

The environment that the oocyte is exposed to during the peri-conception period can have a significant impact on oocyte developmental competence (the ability of the oocyte to support fertilisation and subsequent embryo development) and the long-term health of the resulting offspring. This is particularly true for maternal hyperglycaemia. While maternal hyperglycaemia during early pregnancy through term development has been extensively studied, the effects on the oocyte itself, and the underlying mechanisms, remain largely unknown. There is increasing evidence, however, for the role of the fuel-sensing hexosamine biosynthesis pathway in mediating the effects of hyperglycaemia in many different cell types. In this review, we will focus on the reproductive consequences of maternal hyperglycaemia during the peri-conceptual period and the role of the hexosamine pathway in mediating these processes.Laura A. Frank, Melanie L. Sutton-McDowall, Robert B. Gilchrist, and Jeremy G. Thompso