Phase-coexisting patterns, horizontal segregation and controlled convection in vertically vibrated binary granular mixtures

We report new patterns, consisting of coexistence of sub-harmonic/harmonic and asynchronous states [for example, a granular gas co-existing with (i) bouncing bed, (ii) undulatory subharmonic waves and (iii) Leidenfrost-like state], in experiments on vertically vibrated binary granular mixtures in a Heleshaw-type cell. Most experiments have been carried out with equimolar binary mixtures of glass and steel balls of same diameter by varying the total layer-height ($F$) for a range of shaking acceleration ($\Gamma$). All patterns as well as the related phase-diagram in the ($\Gamma, F$)-plane have been reproduced via molecular dynamics simulations of the same system. The segregation of heavier and lighter particles along the horizontal direction is shown to be the progenitor of such phase-coexisting patterns as confirmed in both experiment and simulation. At strong shaking we uncover a {\it partial} convection state in which a pair of convection rolls is found to coexist with a Leidenfrost-like state. The crucial role of the relative number density of two species on controlling the buoyancy-driven granular convection is demonstrated. A possible model for spontaneous horizontal segregation is suggested based on anisotropic diffusion

Training Graduate Students in Utilization of Analytical Instruments in a Failure Analysis Course

Department of Engineering Technology at University of North Texas offers a graduate course on failure analysis (MSET 5150) during spring semesters. Partial requirement for the course is for students to submit a term paper based on their collected data related to a term project. Case studies are given to groups of students to work on actual failed components received from area industries. Results of their findings are presented at the end of the semester in both oral presentation form and written term paper form followed the format of a well-established technical papers. Results of such exercises allows graduate students devote skills in using scientific instruments and practice manuscript preparations for publication. This paper presents examples of a case studies done by groups of students who worked on failure analysis of components failed in an oil and gas industry. Students developed skills in utilization of scanning electron microscope (SEM), Energy Dispersive Spectroscopy (EDS), and Fourier Transform Infrared Spectrophotometry. This exercise has proven highly effective in introducing young engineers to real world problems in oil and gas industry and help them develop skills needed in performing failure analysis and steps involved.Cockrell School of Engineerin

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

El cuerpo ritual, paisaje y territorio

44 p. Recurso Electr?nicoEste proyecto nace con el inter?s de explorar mi quehacer como artista, Realizo ejercicios de performance como un hecho ritual y art?stico en el departamento del Tolima, Reconociendo el territorio como un espacio de complejidades f?sicas y est?ticas que hacen parte del paisaje creando identidad por el territorio que se habita. De esta manera se realiza una exploraci?n ahondando en las materias org?nicas del territorio tales como las arcillas de diferentes lugares, materialidades escult?ricas en la etapa de creaci?n del proyecto. Empleo el cuerpo como un instrumento de creaci?n y conexi?n con la tierra para explorar el territorio, Un cuerpo que denomino primer territorio de exploraci?n, el cual est? siendo permeado por experiencias propias del performance, Tomando as? el camuflaje como iniciativa de interpretaci?n para habitar paisajes naturales tales como payande, Carmen de Apical?, Nevado del Tolima entre otros, donde el cuerpo experimenta la sensibilidad y espacialidad siendo el tiempo el mediador para tener una experiencia con el camuflaje que genera una desaparici?n o perdida ficticia de la individualidad e identidad en miras de anular mi propia existencia, Creando as? una mirada aptica o metamorfosis y exponiendo mi cuerpo f?sico como una superficie simb?lica de transformaci?n, que ejerce fuerzas f?sicas y ps?quicas sobre un cuerpo que est? siendo interpretado como un cuerpo ritual impregnado por la naturaleza creando una analog?a entre tierra y piel para darle continuidad al cuerpo y el paisaje.This project was born with the interest of hearing my eye as an artist, I perform exercises as a ritual and artistic event in the state of Tolima, Recognizing the territory as a space of physical and aesthetic complexities that are part of the landscape that create identity by The territory that is inhabited In this way an exploration is carried out in the organic matters of the territory stories such as clays from different places, sculptural material in the stage of creation of the project. I use the body as an instrument of creation and connection with the earth to explore the territory, a body that I call the first territory of exploration, which is being permeated by experiences of the operation, thus taking camouflage as the initiative of interpretation for landscapes Natural Tales like payande, Carmen of Apical?, Nevada del Tolima among others, where the body experiences the sensibility and the spatiality the time the mediator to have an experience with the camouflage that generates a disappearance or fictional loss of the individuality and the identity in sights Of annulling My own existence, thus creating a fit look or metamorphosis and exposing my physical body as a symbolic surface of transformation, exerting physical and psychic forces on a body that is being interpreted as a ritual body impregnated by nature creating an analogy between Earth and Skin to give continuity to the body and landscape. Key words: Body, Territory, Landscape, Ritual, Sensitive exploration, Cartographies, Skin, Mimesis, footprints, Continuity folds.Maestro en Artes Pl?sticas y Visuale

Visual Spike-based Convolution Processing with a Cellular Automata Architecture

this paper presents a first approach for implementations which fuse the Address-Event-Representation (AER) processing with the Cellular Automata using FPGA and AER-tools. This new strategy applies spike-based convolution filters inspired by Cellular Automata for AER vision processing. Spike-based systems are neuro-inspired circuits implementations traditionally used for sensory systems or sensor signal processing. AER is a neuromorphic communication protocol for transferring asynchronous events between VLSI spike-based chips. These neuro-inspired implementations allow developing complex, multilayer, multichip neuromorphic systems and have been used to design sensor chips, such as retinas and cochlea, processing chips, e.g. filters, and learning chips. Furthermore, Cellular Automata is a bio-inspired processing model for problem solving. This approach divides the processing synchronous cells which change their states at the same time in order to get the solution.Ministerio de Educación y Ciencia TEC2006-11730-C03-02Ministerio de Ciencia e Innovación TEC2009-10639-C04-02Junta de Andalucía P06-TIC-0141

Estudio fisiográfico-sedimentológico de las rías altas del Norte de Lugo

Esta breve comunicación forma parte de una investigación, cuyo conjunto es tema de la tesis doctoral de uno de nosotros (N. T. R.). Se estudian ciertos fenómenos de erosión y sedimentación que tienen lugar en estas rías del litoral cantábrico, a partir de las características morfológicas y de textura que ofrecen los materiales detríticos litorales y continentales en sus márgenes.Estos accidentes geográficos vienen sufriendo un acentuado fenómeno de relleno por materiales procedentes del mar de tipo arenoso y de tierra, de carácter térreo-fangoso ; tal proceso de relleno se ha acentuado a medida que se han desarrollado las marismas, junqueras y bajos de arena, de tal modo, que actualmente el acceso a las zonas interiores portuarias se hace con dificultad. La deposición de sedimentos es debida al desequilibrio existente entre los aportes de materiales procedentes del mar y de tierra y el poder de arrastre del juego de mareas y corrientes en el ámbito de las rías. En consecuencia, el tema es de gran interés no sólo desde el punto de vista de la investigación científica, sino también utilitario de tipo  técnico, puesto que plantea problemas relacionados con el acceso a zonas portuarias a lo largo de vías de comunicación marítima

Integración de la gestión y el intercambio del conocimiento para apoyar el aprendizaje organizacional y el impacto de la investigación agrícola para el desarrollo

Para potenciar la competitividad, la resiliencia y la sostenibilidad de la agricultura en los países en desarrollo, es necesario un intercambio continuo de procesos y resultados de investigación entre agricultores, expertos en desarrollo, científicos y formuladores de políticas, entre otros. En los últimos años, han surgido nuevas oportunidades que permiten que las organizaciones de investigación adopten prácticas innovadoras que fomentan la gestión y el intercambio del conocimiento, tanto a nivel interno como entre sus respectivas redes. Este documento sintetiza 10 años de experiencia del CIAT y CGIAR en este campo, con énfasis especial en las opciones para integrar la gestión y el intercambio del conocimiento en la investigación para el desarrollo, y está dirigido a profesionales y grupos directivos que buscan adoptar un enfoque integral de este proceso en sus organizaciones y redes

Making the most of meetings: An entry point for knowledge sharing

More effective sharing of the knowledge generated by agricultural research and development (R&D) will enhance global efforts to reduce poverty, hunger and environmental degradation. Major meetings provide a useful opportunity for introducing knowledge sharing (KS) attitudes, methods and tools to R&D organizations. Such events can promote awareness of new types of collegial relationships and foster more creative scientific collaboration. If they are to successfully perform these functions, however, the meeting organizers must plan carefully, identifying the KS techniques that are most appropriate to the defined objectives. Feedback mechanisms (before, during and after the event) are also required. While major meetings can be an entry point for KS into an organization, they will not necessarily lead to mainstreaming of the concept. It is important to incorporate KS into the whole information continuum; a process that includes internal and external communication channels and involves all the organization’s stakeholders. For KS to lead to organizational change and sustainable improvements in performance, top-level management must be committed and meeting results must be followed through

Mainstreaming knowledge management and sharing to support organizational learning and increase the impact of agricultural research for development

Making agriculture more competitive, resilient, and sustainable in developing countries requires continuous sharing of research processes and outcomes between farmers, development experts, scientists, and policymakers, among others. In recent years, new opportunities have emerged for research organizations to adopt innovative practices that foster knowledge management and sharing (referred to subsequently as KM) both internally and within their networks. This policy brief summarizes 10 years of experience with KM in CIAT and CGIAR, with particular emphasis on options for mainstreaming KM in research for development. The document is intended for professionals and management teams interested in a comprehensive KM approach for their organizations and networks

Direct participation of people with communication disabilities in research on poverty and disabilities in low and middle income countries: A critical review

INTRODUCTION: An estimated 1 billion people with disabilities live in low and middle income countries, a population that includes people with communication disabilities (PwCD). PwCD are a heterogenous group with a wide range of abilities who may be underrepresented in research due to the communication demands involved in research participation. METHODS: A critical analysis of 145 studies from a previously published systematic review was undertaken with the aim of documenting the opportunities for direct participation of PwCD in research on poverty and disability in low- and middle- income countries. RESULTS: The key finding was the high risk of underrepresentation of PwCD in research on poverty and disability in LMICs, despite low rates of explicit exclusion (n = 8; 5.5%). A total of 366 uses of data collection tools were analysed (255 unique tools). The majority of data collection tools had high communication demands (92.9%), including those measuring disability (88.6%) and those assessing poverty (100%). Only 22 studies (15.2%) specifically included PwCD. A subset of these studies (n = 14) presented disaggregated data in a way that allowed for analysis of outcomes for PwCD, suggesting a clear intersection between poverty and communication disability, with findings related to general poverty indicators, reduced access to education, low levels of employment, and additional expenditure. CONCLUSIONS: The findings suggest a systematic underrepresentation of PwCD in research on poverty and disability with substantial implications for future policy and program planning, directly affecting the availability and provision of services and resources for this population. A failure to provide adequate opportunity for participation of PwCD in research risks leaving those with communication disabilities behind in the pursuit of global poverty eradication