Computer simulation of the microstructure and rheology of semi-solid alloys under shear

The rheological behavior of metallic alloys containing both solid and liquid phases is investigated in the low solid fraction range (<50%). This behavior depends on both the solid fraction and the shear rate. The concept of Effective Volume Fraction (EVF) is used to decorrelate the influence of these two parameters. At high shear rate the slurry behaves like a suspension of hard spheres, whereas at lower shear rate, particles tend to aggregate in clusters, entrapping liquid and thus, increasing the EVF and the viscosity. A lattice model is introduced to simulate the aggregation / break-up processes within a slurry under shear. When the steady state is reached, the entrapped liquid fraction is calculated, leading to a viscosity estimation. Simulation results for the viscosity and 3D cluster structure are in good agreement with experimental results.Comment: 30 pages, 17 figures, to be published in Acta Mate

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

Effects of ionizing radiation on charge-coupled imagers

The effects of ionizing radiation on three different charge coupled imagers have been investigated. Device performance was evaluated as a function of total gamma ray dose. The principal failure mechanisms have been identified for each particular device structure. The clock and bias voltages required for high total dose operation of the devices are presented

Group IV Nociceptors Develop Axonal Chemical Sensitivity During Neuritis And Following Treatment Of The Sciatic Nerve With Vinblastine

We have previously shown that nerve inflammation (neuritis) and transient vinblastine application lead to axonal mechanical sensitivity in nociceptors innervating deep structures. We have also shown that these treatments reduce axonal transport, and proposed that this leads to functional accumulation of mechanically sensitive channels in the affected part of the axons. While informing the etiology of mechanically induced pain, axonal mechanical sensitivity does not address the common report of ongoing radiating pain during neuritis, which could be secondary to the provocation of axonal chemical sensitivity. We proposed that neuritis and vinblastine application would induce sensitivities to noxious chemicals, and that the number of chemo-sensitive channels would be increased at the affected site. In adult female rats, nerves were either untreated, or treated with complete Freund’s adjuvant (to induce neuritis) or vinblastine. After 3-7 days, dorsal root teased fiber recordings were taken from Group IV neurons with axons within the sciatic nerve. Sciatic nerves were injected intraneurally with a combination of noxious inflammatory chemicals. While no normal sciatic axons responded to this stimulus, 80% and 38% of axons responded in the neuritis and vinblastine groups, respectively. In separate experiments, sciatic nerves were partially ligated and treated with complete Freund’s adjuvant or vinblastine (with controls), and after 3-5 days were immunolabeled for the histamine 3 receptor. The results supported that both neuritis and vinblastine treatment reduce transport of the histamine 3 receptor. The finding that nociceptor axons can develop ectopic chemical sensitivity is consistent with ongoing radiating pain due to nerve inflammation

The competitiveness of the Uruguayan rural tourism sector and its potential to attract German tourists

Purpose – The purpose of this paper is to assess the competitiveness of the Uruguayan rural tourism sector against its main competitors from Argentina and Brazil, as perceived by Uruguayan stakeholders on the supply side. The paper will also evaluate the potential of Uruguay as a rural tourism destination in attracting German tourists. Design/methodology/approach – Two different questionnaires were administered, one to Uruguayan rural tourism stakeholders and another one to potential German tourists in Germany. Findings – The findings indicate that the main strengths of Uruguayan rural tourism offer, compared to Argentina and Brazil, are the hospitality and friendliness of local people, the natural and cultural attractions and the country’s security and safety. Main weaknesses identified were the poor management of several destination components that are key to create a successful tourism destination and poor management of the “demand conditions” component of Dwyer and Kim’s (2003) integrated model. Originality/value – There is very limited research done on the competitiveness of Uruguay as a rural tourist destination in attracting foreign tourists (Mackinnon et al., 2009). The objective of this study is to partially fill this gap by assessing how competitive Uruguayan rural tourism is and evaluating whether Uruguay represents an attractive market for German tourists looking for agro tourism and farm holiday destinations. The German market was chosen because it is one of the top tourist-generating countries and one of the biggest spenders in international tourism (The World Tourism organization, 2010). Moreover, most tourists – from outside South America – selecting Uruguay as a tourist destination come from Germany, USA and Australia (Peralta, 2012)

Can Bio-labels help companies to gain competitive advantage in the organic food market in Germany?

Consumers’ attitudes towards food underwent large changes in Germany. This has resulted in an increase of demand for organic food. However, some analysts claim that the organic food market in Germany might be maturing. Within this context, this paper has two main objectives: first, to explore the attitude of German consumers towards organic food and bio-labels; and second to identify potential areas for improvement to help organic food companies to become more competitive. This study used a quantitative research approach. 627 German consumers completed the survey. The results of this study indicate that there is potential for the organic food market to carry on growing. Findings have also revealed that a large percentage of participants do not trust some bio-labels. Trust and brand recognition are the most important factors that have helped Bioland and Demeter to develop a competitive advantage against other labels

An Exploratory Research of the Potential Strategic Benefits of Specialising in Riesling Grape: A Case Study from the Niagara Wine Region

Abstract The main purpose of this paper is to evaluate the current business strategy of the Niagara wine region and to explore the potential of the Niagara wine region to specialise in Riesling grape variety. Questionnaires were administered to a range of different types of experts with a specialty in wine. Quantitative data from the Liquor Control Board of Ontario supplemented the core interviews. The results of this study indicate that differentiation through specialisation is the best strategy to develop the Niagara wine region. However, the structure of the wine industry encourages wineries to produce a vast array of grape varieties to cater to the needs of the domestic market. This has resulted in a loss of identity for the region. Though because Niagara Riesling is differentiable, world class, the most consistently awarded grape and unreproducible elsewhere, it is the prime candidate to become the representative grape for the region. By developing the Niagara style of Riesling and focusing on exporting small amounts of the variety, the region would benefit by developing an identity and increasing consumer confidence and sales. Keyword

Does the Conventional Paradigm help to Analyze the Competitiveness of an Industry?

Literature on strategic management has been recently criticised for not being able to explain the success of a number of companies. Within this context, this paper has two main objectives: first, to assess whether one of the most comprehensive strategy models, Porter’s diamond (1990) remains valuable to analyse the competitiveness of the Zimbabwean aquaculture industry; and second to produce recommendations to improve the competitiveness of the Zimbabwean tilapia industry. This study uses an intensive research approach, by means of in-depth personal interviews with stakeholders from the selected industry. The results of this study indicate that 26 years after its development, Porter’s diamond remains a valuable tool to analyse the competitiveness of the Zimbabwean aquaculture industry. Findings have revealed that the main strengths of the Zimbabwean tilapia industry are the availability of natural resources and labour costs. Main weaknesses identified through Porter’s framework are: lack of access to capital; lack of access to technology; lack of skilled workers and lack of adequate infrastructure. The findings of this research make a contribution to the existing literature by extending the discussion on the suitability of conventional theory to explain firm competitiveness. To date no other research has been carried out in relation to the development of tilapia aquaculture in Zimbabwe

Late harvest as factor affecting esca and Botryosphaeria dieback prevalence of vineyards in the Alsace region of France

The decline of grapevines due to esca and Botryosphaeria dieback (Bot. dieback) is a serious problem in the Alsace region of France. A survey of 82 vineyards over 8 years showed that among a set of agronomical and cultural variables, esca and Bot. dieback prevalence correlated to the harvest dates, especially late harvest dates for the production of sweet wines. The interpretation of this finding that points to the carbon balance of the vine and its reserves status as possible causation is discussed. Under this hypothesis the data also point to climatic variables as factors in the disease epidemiology, with a lag phase of about one year.

СУЧАСНІ ПОГЛЯДИ НА ПАТОГЕНЕЗ ЕКСТРАГЕНІТАЛЬНОГО ЕНДОМЕТРІОЗУ (Огляд літератури)

SUMMARY. Endometriosis is a chronic benign hormone-dependent condition in which endometrium spreads and grows outside the uterine mucosa, with identical to eutopic endometrium morphological and functional properties. This review is dedicated to modern view on pathogenesis of extragenital endometriosis. The article presents both the theory of etiology and pathogenesis of this pathology and possible mechanisms that can potentially be considered as the key to pathogenetic therapy. Endometriosis is detected in 50 % of women with dysmenorrhea, in 50–80 % of patients with chronic pelvic pain and in 25–40 % of women with infertility, and in the structure of gynecological disease, endometriosis ranks third after inflammatory processes and uterine fibroids. Сonsidering the not-too-high effectiveness of treatment, a significant percentage of recurrence of the disease, the issue of updating views on pathogenetic mechanisms in order to optimize the therapeutic endometriosis tactic still remains relevant. The aim – to conduct the literature analysis in order to identify contemporary views on the pathogenesis of extragenital endometriosis and possible points of application in the development of targeted therapy. Conclusions. The most widely accepted theory of pathogenesis of endometriosis is the theory of retrospective menstruation of Sampson. This theory suggests that viable fragments of the endometrial tissue disintegrate into the peritoneal cavity or into the pelvic organs. The most probable evolution of this theory should be the theory of angiogenesis on the background of immune dysfunction, which contributes to the primary implantation of endometrioid ectopic and their subsequent development. Modern literature points to the role of angiogenesis in the formation and development of lesions, but at the same time, there is an immune dysfunction, which probably leads to the predominance of angiogenic factors locally.РЕЗЮМЕ. Эндометриоз – это хроническое доброкачественное гормонозависимое состояние, при котором за пределами слизистой оболочки матки происходит разрастание ткани, по морфологическим и функциональным свойствам идентичной эндометрию. Приведены данные обзора литературы, посвященные современным взглядам относительно патогенеза экстрагенитального эндометриоза. В статье приведены как теории этиологии и патогенеза данной патологии, так и возможные механизмы, которые могут рассматриваться как ключ к патогенетической терапии. Эндометриоз обнаруживают у 50 % женщин с дисменореей, у 50–80 % пациенток с хронической тазовой болью и у 25–40 % женщин с бесплодием, а в структуре гинекологической заболеваемости эндометриоз занимает третье место после воспалительных процессов и миомы матки. Учитывая не слишком высокую эффективность лечения, значительный процент рецидивов заболевания вопрос актуализации взглядов на патогенетические механизмы с целью оптимизации лечебной тактики эндометриоза до сих пор остается актуальным. Цель – провести анализ литературы с целью выявления современных взглядов относительно патогенеза екстрагениатльного эндометриоза и возможных точек приложения при разработке таргетной терапии. Выводы. Наиболее широко принятой теорией патогенеза эндометриоза является теория ретроградной менструации Сэмпсона. Данная теория предполагает, что жизнеспособные фрагменты эндометрия ткани дисеминируються в перитонеальную полость или в органы малого таза. Наиболее вероятным эволюционированием данной теории следует считать теорию ангиогенеза на фоне иммунной дисфункции, которая способствует первичной имплантации эндометриоидных эктопий и их дальнейшему развитию. Современные данные литературы ставят во главу угла роль ангиогенеза в становлении и развитии поражений, в то же время имеет место иммунная дисфункция, которая, вероятно, приводит к преобладанию ангиогенных факторов локально.РЕЗЮМЕ. Ендометріоз – це хронічний доброякісний гормонозалежний стан, при якому за межами слизової оболонки матки відбувається розростання тканини, за морфологічними та функціональними властивостями ідентичної ендометрію. Наведені дані огляду літератури присвячені сучасним поглядам на патогенез екстрагенітального ендометріозу. В статті висвітлені теорії щодо етіології та патогенезу цієї патології, а також описані можливі механізми, які потенційно можна розглядати як ключ до патогенетичної терапії. Ендометріоз виявляють у 50 % жінок з дисменореєю, у 50–80 % пацієнток із хронічним тазовим болем та у 25–40 % жінок із безпліддям, а в структурі гінекологічної захворюваності ендометріоз посідає третє місце після запальних процесів та міоми матки. Враховуючи не надто високу ефективність лікування та значний відсоток рецидивування захворювання питання актуалізації поглядів на патогенетичні механізми з метою оптимізації лікувальної тактики ендометріозу й досі залишається актуальним. Мета – провести аналіз літератури з метою виявлення сучасних поглядів щодо патогенезу екстрагеніатльного ендометріозу та можливі точки прикладання при розробці таргетної терапії. Висновки. Найширше прийнятою теорією патогенезу ендометріозу є теорія ретроградної менструації Семпсона. Ця теорія припускає, що життєздатні фрагменти ендометріальної тканини дисемінуються в перитонеальну порожнину або в органи малого таза. Найімовірнішим еволюціонуванням даної теорії слід вважати теорію ангіогенезу на тлі імунної дисфункції, яка сприяє первинній імплантації ендометріоїдних ектопій та їх подальшому розвитку. Сучасні дані літератури ставлять на чільне місце в становленні та розвитку уражень роль ангіогенезу, водночас має місце імунна дисфункція, яка, ймовірно, призводить до переважання ангіогенних факторів локально