Bacterial tail anchors can target to the mitochondrial outer membrane

Background: During the generation and evolution of the eukaryotic cell, a proteobacterial endosymbiont was re-fashioned into the mitochondrion, an organelle that appears to have been present in the ancestor of all present-day eukaryotes. Mitochondria harbor proteomes derived from coding information located both inside and outside the organelle, and the rate-limiting step toward the formation of eukaryotic cells may have been development of an import apparatus allowing protein entry to mitochondria. Currently, a widely conserved translocon allows proteins to pass from the cytosol into mitochondria, but how proteins encoded outside of mitochondria were first directed to these organelles at the dawn of eukaryogenesis is not clear. Because several proteins targeted by a carboxyl-terminal tail anchor (TA) appear to have the ability to insert spontaneously into the mitochondrial outer membrane (OM), it is possible that self-inserting, tail-anchored polypeptides obtained from bacteria might have formed the first gate allowing proteins to access mitochondria from the cytosol. Results: Here, we tested whether bacterial TAs are capable of targeting to mitochondria. In a survey of proteins encoded by the proteobacterium Escherichia coli, predicted TA sequences were directed to specific subcellular locations within the yeast Saccharomyces cerevisiae. Importantly, TAs obtained from DUF883 family members ElaB and YqjD were abundantly localized to and inserted at the mitochondrial OM. Conclusions: Our results support the notion that eukaryotic cells are able to utilize membrane-targeting signals present in bacterial proteins obtained by lateral gene transfer, and our findings make plausible a model in which mitochondrial protein translocation was first driven by tail-anchored proteins.Peer reviewe

A bacteria-derived tail anchor localizes to peroxisomes in yeast and mammalian cells

Prokaryotes can provide new genetic information to eukaryotes by horizontal gene transfer (HGT), and such transfers are likely to have been particularly consequential in the era of eukaryogenesis. Since eukaryotes are highly compartmentalized, it is worthwhile to consider the mechanisms by which newly transferred proteins might reach diverse organellar destinations. Toward this goal, we have focused our attention upon the behavior of bacteria-derived tail anchors (TAs) expressed in the eukaryote Saccharomyces cerevisiae. In this study, we report that a predicted membrane-associated domain of the Escherichia coli YgiM protein is specifically trafficked to peroxisomes in budding yeast, can be found at a pre-peroxisomal compartment (PPC) upon disruption of peroxisomal biogenesis, and can functionally replace an endogenous, peroxisome-directed TA. Furthermore, the YgiM(TA) can localize to peroxisomes in mammalian cells. Since the YgiM(TA) plays no endogenous role in peroxisomal function or assembly, this domain is likely to serve as an excellent tool allowing further illumination of the mechanisms by which TAs can travel to peroxisomes. Moreover, our findings emphasize the ease with which bacteria-derived sequences might target to organelles in eukaryotic cells following HGT, and we discuss the importance of flexible recognition of organelle targeting information during and after eukaryogenesis.Peer reviewe

Exploring a non-canonical mode of gene regulation mediated by mRNA transcript isoform switching in the context of mammalian development

Long undecoded transcript isoforms (LUTIs) are a class of non-canonical mRNAs that repress gene expression by a combined mechanism of transcriptional and translational interference. Although this mechanism has been shown to be widespread in yeast, its prevalence in mammals has not been established. Using human embryonic stem cells (hESCs) differentiated into endoderm, mesoderm, and ectoderm lineages and further differentiation into polyhormonal cells, cardiomyocytes, and motor neurons, respectively, we obtained a comprehensive dataset through mRNA-seq, ribosome profiling, and quantitative mass spectrometry measurements. Our analysis revealed that LUTI-based regulation is context-dependent, with a total of 271 genes identified in ectoderm to motor neuron differentiation, 69 genes in mesoderm to cardiomyocyte differentiation, and 99 genes in endoderm to polyhormonal cell differentiation. Translational repression of LUTI candidates was found to be primarily dependent on upstream open reading frames (uORFs), while LUTI-based transcriptional repression displayed variability. This study enhances our understanding of gene expression and regulation during mammalian development and highlights the potential significance of LUTI-based regulation in the development of specific cell types or tissues. The findings lay the groundwork for further exploration into the role of LUTI- based regulation in other mammalian developmental programs and its potential implications for therapeutic targets in developmental disorders and diseases

Energy-Efficient Train Operation Using Nature-Inspired Algorithms

A train operation optimization by minimizing its traction energy subject to various constraints is carried out using nature-inspired evolutionary algorithms. The optimization process results in switching points that initiate cruising and coasting phases of the driving. Due to nonlinear optimization formulation of the problem, nature-inspired evolutionary search methods, Genetic Simulated Annealing, Firefly, and Big Bang-Big Crunch algorithms were employed in this study. As a case study a real-like train and test track from a part of Eskisehir light rail network were modeled. Speed limitations, various track alignments, maximum allowable trip time, and changes in train mass were considered, and punctuality was put into objective function as a penalty factor. Results have shown that all three evolutionary methods generated effective and consistent solutions. However, it has also been shown that each one has different accuracy and convergence characteristics

THE POSSIBLE EFFECTS OF SYRIAN IMMIGRANTS IN LABOR MARKETS IN TURKEY AND YALOVA SAMPLE - SURİYELİ GÖÇMENLERİN TÜRKİYE EMEK PİYASASINA ETKİLERİ VE YALOVA ÖRNEĞİ

Suriye'deki iç savaş sadece Suriye'yi değil, tüm Ortadoğu Bölgesi'ni etkilemektedir. Birçok Suriyeli komşu ülkelere göç etmek zorunda kalmıştır. Bunların 2 milyon kadarı Türkiye'ye göç etmiştir. Türkiye'de bulunan bu göçmenlerin %15 kadarı onlar için kurulan kamplarda yaşarken, diğerleri farklı şehirlerde kendi imkanları ile yaşamaktadırlar. Göçmenlerin bazıları sınır şehirlerinde kalmayı tercih ederken, büyük bir çoğunluğu da İstanbul, Ankara, İzmir ve Yalova gibi batı şehirlerinde yaşamayı tercih etmişlerdir. Türkiye Hükümeti Suriyeli göçmenlerin ihtiyaçları için 2016 yılı sonuna kadar 10 milyar USD kadar harcama yapmıştır. Yüksek kiralar, yüksek fiyatlar, emek piyasasında çalışma zorlukları nedeniyle Suriyeli göçmenler yaşamlarını idame ettirmekte önemli zorluklarla karşı karşıya kalmaktadırlar. Sağlık sorunlarına ilave olarak, işsiz ve evsiz olan göçmenler de bulunmaktadır. Türkiye Hükümeti göçmenlerin ücretsiz sağlık hizmetlerinden faydalanmalarını sağlamanın yanında bazı belediyeler de barınma imkanları sağlamaktadırlar. Ayrıca ekonomik ve sosyal olarak içerilmelerini sağlamak amacıyla çalışma izni de verilmiştir. Bu çalışma İstanbul'a çok yakın olan Yalova ilinde yaşayan Suriyeli göçmenlerin durumlarını tespit etmeye çalışmaktadır. Yalova ilinde yaşayan Suriyeli göçmenlerle anket çalışması yapılmıştır. Yapılan anket çalışmasında toplanan veriler ile nasıl yaşadıkları, emek piyasasına ve iş fırsatlarına nasıl ulaştıkları anlaşılmaya çalışılacaktır. Birinci kısımda literatür çalışması yapılmıştır. İkinci kısımda ise yapılan saha çalışması analiz edilmiştir. Anahtar Kelimeler: Göç, Suriyeli Göçmenler, Yalova

Data from: Evidence for amino acid snorkeling from a high-resolution, in vivo analysis of Fis1 tail anchor insertion at the mitochondrial outer membrane

Proteins localized to mitochondria by a carboxyl-terminal tail anchor (TA) play roles in apoptosis, mitochondrial dynamics, and mitochondrial protein import. To reveal characteristics of TAs that may be important for mitochondrial targeting, we focused our attention upon the TA of the Saccharomyces cerevisiae Fis1 protein. Specifically, we generated a library of Fis1p TA variants fused to the Gal4 transcription factor, then, using next-generation sequencing, revealed which Fis1p TA mutations inhibited membrane insertion and allowed Gal4p activity in the nucleus. Prompted by our global analysis, we subsequently analyzed the ability of individual Fis1p TA mutants to localize to mitochondria. Our findings suggest that the membrane-associated domain of the Fis1p TA may be bipartite in nature, and we encountered evidence that the positively charged patch at the carboxyl-terminus of Fis1p is required for both membrane insertion and organelle specificity. Furthermore, lengthening or shortening of the Fis1p TA by up to three amino acids did not inhibit mitochondrial targeting, arguing against a model in which TA length directs insertion of TAs to distinct organelles. Most importantly, positively charged residues were more acceptable at several positions within the membrane-associated domain of the Fis1p TA than negatively charged residues. These findings, emerging from the first high-resolution analysis of an organelle targeting sequence by deep mutational scanning, provide strong, in vivo evidence that lysine and arginine can "snorkel," or become stably incorporated within a lipid bilayer by placing terminal charges of their side chains at the membrane interface

Keskin_AmpliconSequencingFis1TA

A pool of plasmids containing Fis1p TA mutations in a Gal4-sfGFP-Fis1 fusion protein and constructed using degenerate primers was cultured in strain MaV203 for four generations in SC-Trp medium, SC-Ura medium, or SMM-Trp-His medium containing 0 mM, 5 mM, 10 mM, or 20 mM 3-AT. Plasmids present under each culture condition were then recovered from 10 OD600 units of cells. Primers 882 (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGTAGAGGATAAGATCCAGAAGGAAAC) and 883 (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCATAAGAAATTCGCTTATTTAGAAGTG) were used to amplify the genomic region encoding the Fis1p TA from each plasmid pool. Using the provided PCR products, next-generation, paired-end sequencing was performed by Microsynth (Balgach, Switzerland) on a MiSeq Nano (2x150v2). GZIP-compressed FASTQ files and a commercial sequencing report are found in the associated ZIP file

Pleurotus eryngii (DC. Ex Fr.) Quel’in Farklı Çözücülerle Elde Edilen Özütlerinin Besinsel Içeriğinin, Antioksidan Antikanser ve Antimikrobiyal Aktivitelerinin Araştırılması

The present study related the nutritional contents, fatty acidcompositions, in vitro antioxidant, anticancer and antimicrobialactivities of different solvents extracts of Pleurotus eryngii. Thenutritional contents of the P. eryngii were investigated in detail.Crude protein (g 100 kg-1), carbohydrate (g 100 kg-1), lipid (g 100 kg1), ash (g 100 kg-1), dietary fiber (g 100 kg-1) and energy value (cal100 g-1) of fruiting bodies were analysed. Fatty acid compositions oftotal lipid, phospholipid and triacylglycerol fractions of Pleurotuseryngii were investigated by Gas chromatography. Totally 13 differentfatty acids constituents were identified. Antioxidant propertiesincluding total antioxidant activity, free radical scavenging activity,reducing power activity, metal chelating activity, and superoxideanion radical scavenging activity were evaluated using different tests.The highest total antioxidant, DPPH scavenging, metal chelating, andsuperoxide anion radical scavenging activities were determined inethyl acetate extracts. The potential of cytotoxic activity on PC-3(prostate cancer) cell lines was found to depend on the concentrationand the type of the tested extracts fractions. It was determined thathexane, ethyl acetate, and methanol extracts of Pleurotus eryngii haveinhibition effect on the growth of tested microorganisms. The presentresults suggested that used as a daily nutrient, the Pleurotus eryngiicould be a novel source for new drug developments and promising insome cancer treatment.Bu çalışma Pleurotus eryngii'nin farklı çözücü ekstraktlarının besinsel içerikleri, yağ asidi bileşimleri, in vitro antioksidan, antikanser ve antimikrobiyal aktiviteleri ile ilgilidir. P. eryngii'nin besinsel içeriği ayrıntılı olarak araştırıldı. Meyve gövdesinin ham protein (g 100 kg-1), karbonhidrat (g 100 kg-1), lipit (g 100 kg-1), kül (g 100 kg-1), diyet lifi (g 100 kg-1) ve enerji değeri (100 g-1) analiz edildi. Pleurotus eryngii'nin toplam lipit, fosfolipid ve triaçilgliserol fraksiyonlarının yağ asidi bileşimleri Gaz kromatografisi ile araştırıldı. Toplam 13 farklı yağ asidi bileşeni belirlendi. Toplam antioksidan aktivite, serbest radikal süpürme aktivitesi, indirgeme gücü aktivitesi, metal şelatlama aktivitesi ve süperoksit anyon radikali süpürme aktivitesini içeren antioksidan özellikler farklı testler kullanılarak değerlendirildi. En yüksek toplam antioksidan, DPPH radikali süpürme, metal şelatlama ve süperoksit anyon radikal süpürme aktiviteleri etil asetat özütünde belirlendi. PC-3 (prostat kanseri) hücre hattı üzerindeki sitotoksik aktivite potansiyelinin, test edilen özüt fraksiyonlarının konsantrasyonuna ve tipine bağlı olduğu bulundu. Pleurotus eryngii'nin heksan, etil asetat ve metanol ekstraktlarının, test edilen mikroorganizmaların büyümesini inhibe edici etkiye sahip olduğu belirlendi. Mevcut sonuçlar, günlük besin olarak kullanılan Pleurotus eryngii'nin yeni ilaç gelişmeleri ve bazı kanser tedavilerinde umut vaat eden yeni bir kaynak olabileceğini düşündürmektedir