Coping styles in patients with anxiety and depression

Different individuals use different coping styles to cope with their problems. In patients with anxiety and/or depression, these have important implications. The primary objective of our study was to estimate the frequency of different coping mechanisms used by patients with symptoms of anxiety and depression. A descriptive, cross-sectional survey was conducted and patients with symptoms of anxiety and depression were identified using the Aga Khan University\u27s Anxiety and Depression Scale (AKUADS). Coping styles were determined by using the 28-item Brief COPE inventory. We were able to recruit 162 people. The prevalence of anxiety and depression was found to be 34%. Females were more than 2 times likely to have anxiety and depression (P value = 0.024, OR = 2.62). In patients screening positive for AKUADS, religion was the most common coping mechanism identified. Acceptance , Use of instrumental support , and Active coping were other commonly used coping styles. Our findings suggest that religious coping is a common behavior in patients presenting with symptoms anxiety and depression in Pakistan. Knowledge of these coping styles is important in the care of such patients, as these coping methods can be identified and to some extent modified by the treating clinician/psychiatrist

Frequency of Subdural and Epidural Hematoma in Brain Injury Via Computed Tomography in Trauma Center of DHQ Teaching Hospital Sargodha

At least 10 million TBIs serious enough to result in death or hospitalization occur annually. The mortality associated with acute subdural hematoma has been reported to range from 36-79%. Epidural hematoma occurs in approximately 2% of patients with head injuries and 5–15% of patients with fatal head injuries. Both can be caused by fall, motor vehicle crashes, assaults, blasts and sports activities. CT is best modality for diagnosis of brain injury. Objective:To measure the frequency of subdural and epidural hematoma in brain injury via computed tomography in trauma center of DHQ Teaching Hospital Sargodha.Methodology:In this descriptive study, among 137 patients of traumatic brain injury (TBIs) were selected with age and gender discrimination by convenient sampling, at Department of Radiology, DHQ Teaching Hospital Sargodha. Single slice Computed Tomography Toshiba asteion machine was used.Results:Out of 137 patients collected, 35 were females and 102 were males who visited emergency department due to brain Injury. It shows 25.5% were females and males were 74.5%.Out of 137 patients, 63.5% were injured with RTA and 35.8% came with the history of fall. 67.2% patients present with loss of consciousness, 67.9% patients with skull fractures and 73% with swelling. Out of 137 patients 85.4% develop SDH and 14.6% develop EDH. Conclusion:In this study we conclude that male develop larger number of brain injuries than females. Most patients with history of RTA had epidural hematoma. Females most likely develop subdural hematoma. Most patients with brain injury later develop subdural hematoma. Keywords: Subdural Hematoma, Epidural Hematoma, Traumatic Brain Injury(TBI), Road Traffic Accident(RTA) DOI: 10.7176/JHMN/71-01 Publication date: February 29th 202

Molecular characterization of capsid protein gene of potato virus X from Pakistan

Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).Keywords: Potato virus X, capsid protei

Careers work in higher education in Pakistan: current practice and options for the future

In this article we examine the development of career guidance in Pakistani higher education. The article is primarily based on a review of the existing literature on career guidance in Pakistan, but also includes the consideration of some new data gathered from a review of higher education institutions websites and five case study interviews. It considers both local and global influences as relevant contexts for understanding how the development of career guidance in Pakistani higher education is taking place. Concerns about alignment between skills supply and demand provide key drivers both for the development of career guidance and for wider higher education reform. However the practice of career guidance in Pakistani higher education is shown to be lagging behind the policy aspirations, both due to limited investment and due to more fundamental cultural challenges that have yet to be fully addressed. If career guidance is going to continue to develop within Pakistan it will need to be strengthened by new policy and resources but also through the development of indigenous theories.N/

Reducing the environmental impact of surgery on a global scale: systematic review and co-prioritization with healthcare workers in 132 countries

Background Healthcare cannot achieve net-zero carbon without addressing operating theatres. The aim of this study was to prioritize feasible interventions to reduce the environmental impact of operating theatres. Methods This study adopted a four-phase Delphi consensus co-prioritization methodology. In phase 1, a systematic review of published interventions and global consultation of perioperative healthcare professionals were used to longlist interventions. In phase 2, iterative thematic analysis consolidated comparable interventions into a shortlist. In phase 3, the shortlist was co-prioritized based on patient and clinician views on acceptability, feasibility, and safety. In phase 4, ranked lists of interventions were presented by their relevance to high-income countries and low–middle-income countries. Results In phase 1, 43 interventions were identified, which had low uptake in practice according to 3042 professionals globally. In phase 2, a shortlist of 15 intervention domains was generated. In phase 3, interventions were deemed acceptable for more than 90 per cent of patients except for reducing general anaesthesia (84 per cent) and re-sterilization of ‘single-use’ consumables (86 per cent). In phase 4, the top three shortlisted interventions for high-income countries were: introducing recycling; reducing use of anaesthetic gases; and appropriate clinical waste processing. In phase 4, the top three shortlisted interventions for low–middle-income countries were: introducing reusable surgical devices; reducing use of consumables; and reducing the use of general anaesthesia. Conclusion This is a step toward environmentally sustainable operating environments with actionable interventions applicable to both high– and low–middle–income countries

Reducing the environmental impact of surgery on a global scale: systematic review and co-prioritization with healthcare workers in 132 countries

Abstract Background Healthcare cannot achieve net-zero carbon without addressing operating theatres. The aim of this study was to prioritize feasible interventions to reduce the environmental impact of operating theatres. Methods This study adopted a four-phase Delphi consensus co-prioritization methodology. In phase 1, a systematic review of published interventions and global consultation of perioperative healthcare professionals were used to longlist interventions. In phase 2, iterative thematic analysis consolidated comparable interventions into a shortlist. In phase 3, the shortlist was co-prioritized based on patient and clinician views on acceptability, feasibility, and safety. In phase 4, ranked lists of interventions were presented by their relevance to high-income countries and low–middle-income countries. Results In phase 1, 43 interventions were identified, which had low uptake in practice according to 3042 professionals globally. In phase 2, a shortlist of 15 intervention domains was generated. In phase 3, interventions were deemed acceptable for more than 90 per cent of patients except for reducing general anaesthesia (84 per cent) and re-sterilization of ‘single-use’ consumables (86 per cent). In phase 4, the top three shortlisted interventions for high-income countries were: introducing recycling; reducing use of anaesthetic gases; and appropriate clinical waste processing. In phase 4, the top three shortlisted interventions for low–middle-income countries were: introducing reusable surgical devices; reducing use of consumables; and reducing the use of general anaesthesia. Conclusion This is a step toward environmentally sustainable operating environments with actionable interventions applicable to both high– and low–middle–income countries

Dimethyl fumarate in patients admitted to hospital with COVID-19 (RECOVERY): a randomised, controlled, open-label, platform trial

Dimethyl fumarate (DMF) inhibits inflammasome-mediated inflammation and has been proposed as a treatment for patients hospitalised with COVID-19. This randomised, controlled, open-label platform trial (Randomised Evaluation of COVID-19 Therapy [RECOVERY]), is assessing multiple treatments in patients hospitalised for COVID-19 (NCT04381936, ISRCTN50189673). In this assessment of DMF performed at 27 UK hospitals, adults were randomly allocated (1:1) to either usual standard of care alone or usual standard of care plus DMF. The primary outcome was clinical status on day 5 measured on a seven-point ordinal scale. Secondary outcomes were time to sustained improvement in clinical status, time to discharge, day 5 peripheral blood oxygenation, day 5 C-reactive protein, and improvement in day 10 clinical status. Between 2 March 2021 and 18 November 2021, 713 patients were enroled in the DMF evaluation, of whom 356 were randomly allocated to receive usual care plus DMF, and 357 to usual care alone. 95% of patients received corticosteroids as part of routine care. There was no evidence of a beneficial effect of DMF on clinical status at day 5 (common odds ratio of unfavourable outcome 1.12; 95% CI 0.86-1.47; p = 0.40). There was no significant effect of DMF on any secondary outcome

Effect of angiotensin-converting enzyme inhibitor and angiotensin receptor blocker initiation on organ support-free days in patients hospitalized with COVID-19

IMPORTANCE Overactivation of the renin-angiotensin system (RAS) may contribute to poor clinical outcomes in patients with COVID-19. Objective To determine whether angiotensin-converting enzyme (ACE) inhibitor or angiotensin receptor blocker (ARB) initiation improves outcomes in patients hospitalized for COVID-19. DESIGN, SETTING, AND PARTICIPANTS In an ongoing, adaptive platform randomized clinical trial, 721 critically ill and 58 non–critically ill hospitalized adults were randomized to receive an RAS inhibitor or control between March 16, 2021, and February 25, 2022, at 69 sites in 7 countries (final follow-up on June 1, 2022). INTERVENTIONS Patients were randomized to receive open-label initiation of an ACE inhibitor (n = 257), ARB (n = 248), ARB in combination with DMX-200 (a chemokine receptor-2 inhibitor; n = 10), or no RAS inhibitor (control; n = 264) for up to 10 days. MAIN OUTCOMES AND MEASURES The primary outcome was organ support–free days, a composite of hospital survival and days alive without cardiovascular or respiratory organ support through 21 days. The primary analysis was a bayesian cumulative logistic model. Odds ratios (ORs) greater than 1 represent improved outcomes. RESULTS On February 25, 2022, enrollment was discontinued due to safety concerns. Among 679 critically ill patients with available primary outcome data, the median age was 56 years and 239 participants (35.2%) were women. Median (IQR) organ support–free days among critically ill patients was 10 (–1 to 16) in the ACE inhibitor group (n = 231), 8 (–1 to 17) in the ARB group (n = 217), and 12 (0 to 17) in the control group (n = 231) (median adjusted odds ratios of 0.77 [95% bayesian credible interval, 0.58-1.06] for improvement for ACE inhibitor and 0.76 [95% credible interval, 0.56-1.05] for ARB compared with control). The posterior probabilities that ACE inhibitors and ARBs worsened organ support–free days compared with control were 94.9% and 95.4%, respectively. Hospital survival occurred in 166 of 231 critically ill participants (71.9%) in the ACE inhibitor group, 152 of 217 (70.0%) in the ARB group, and 182 of 231 (78.8%) in the control group (posterior probabilities that ACE inhibitor and ARB worsened hospital survival compared with control were 95.3% and 98.1%, respectively). CONCLUSIONS AND RELEVANCE In this trial, among critically ill adults with COVID-19, initiation of an ACE inhibitor or ARB did not improve, and likely worsened, clinical outcomes. TRIAL REGISTRATION ClinicalTrials.gov Identifier: NCT0273570

Mortality from gastrointestinal congenital anomalies at 264 hospitals in 74 low-income, middle-income, and high-income countries: a multicentre, international, prospective cohort study

Summary Background Congenital anomalies are the fifth leading cause of mortality in children younger than 5 years globally. Many gastrointestinal congenital anomalies are fatal without timely access to neonatal surgical care, but few studies have been done on these conditions in low-income and middle-income countries (LMICs). We compared outcomes of the seven most common gastrointestinal congenital anomalies in low-income, middle-income, and high-income countries globally, and identified factors associated with mortality. Methods We did a multicentre, international prospective cohort study of patients younger than 16 years, presenting to hospital for the first time with oesophageal atresia, congenital diaphragmatic hernia, intestinal atresia, gastroschisis, exomphalos, anorectal malformation, and Hirschsprung’s disease. Recruitment was of consecutive patients for a minimum of 1 month between October, 2018, and April, 2019. We collected data on patient demographics, clinical status, interventions, and outcomes using the REDCap platform. Patients were followed up for 30 days after primary intervention, or 30 days after admission if they did not receive an intervention. The primary outcome was all-cause, in-hospital mortality for all conditions combined and each condition individually, stratified by country income status. We did a complete case analysis. Findings We included 3849 patients with 3975 study conditions (560 with oesophageal atresia, 448 with congenital diaphragmatic hernia, 681 with intestinal atresia, 453 with gastroschisis, 325 with exomphalos, 991 with anorectal malformation, and 517 with Hirschsprung’s disease) from 264 hospitals (89 in high-income countries, 166 in middleincome countries, and nine in low-income countries) in 74 countries. Of the 3849 patients, 2231 (58·0%) were male. Median gestational age at birth was 38 weeks (IQR 36–39) and median bodyweight at presentation was 2·8 kg (2·3–3·3). Mortality among all patients was 37 (39·8%) of 93 in low-income countries, 583 (20·4%) of 2860 in middle-income countries, and 50 (5·6%) of 896 in high-income countries (p<0·0001 between all country income groups). Gastroschisis had the greatest difference in mortality between country income strata (nine [90·0%] of ten in lowincome countries, 97 [31·9%] of 304 in middle-income countries, and two [1·4%] of 139 in high-income countries; p≤0·0001 between all country income groups). Factors significantly associated with higher mortality for all patients combined included country income status (low-income vs high-income countries, risk ratio 2·78 [95% CI 1·88–4·11], p<0·0001; middle-income vs high-income countries, 2·11 [1·59–2·79], p<0·0001), sepsis at presentation (1·20 [1·04–1·40], p=0·016), higher American Society of Anesthesiologists (ASA) score at primary intervention (ASA 4–5 vs ASA 1–2, 1·82 [1·40–2·35], p<0·0001; ASA 3 vs ASA 1–2, 1·58, [1·30–1·92], p<0·0001]), surgical safety checklist not used (1·39 [1·02–1·90], p=0·035), and ventilation or parenteral nutrition unavailable when needed (ventilation 1·96, [1·41–2·71], p=0·0001; parenteral nutrition 1·35, [1·05–1·74], p=0·018). Administration of parenteral nutrition (0·61, [0·47–0·79], p=0·0002) and use of a peripherally inserted central catheter (0·65 [0·50–0·86], p=0·0024) or percutaneous central line (0·69 [0·48–1·00], p=0·049) were associated with lower mortality. Interpretation Unacceptable differences in mortality exist for gastrointestinal congenital anomalies between lowincome, middle-income, and high-income countries. Improving access to quality neonatal surgical care in LMICs will be vital to achieve Sustainable Development Goal 3.2 of ending preventable deaths in neonates and children younger than 5 years by 2030