Eine neue Methode zur Trennung von Eisen und Thonerde

n/

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer

Echocardiographic AV-interval optimization in patients with reduced left ventricular function

BACKGROUND: Ritter's method is a tool used to optimize AV delay in DDD pacemaker patients with normal left ventricular function only. The goal of our study was to evaluate Ritter's method in AV delay-interval optimization in patients with reduced left ventricular function. METHODS: Patients with implanted DDD pacemakers and AVB III° were assigned to one of two groups according to ejection fraction (EF): Group 1 (EF > 35%) and Group 2 (EF < 35%). AV delay optimization was performed by means of radionuclide ventriculography (RNV) and application of Ritter's method. RESULTS: For each of the patients examined, we succeeded in defining an optimal AV interval by means of both RNV and Ritter's method. The optimal AV delay determined by RNV correlated well with the delay found by Ritter's method, especially among those patients with reduced EF. The intra-class correlation coefficient was 0.8965 in Group 1 and 0.9228 in Group 2. The optimal AV interval in Group 1 was 190 ± 28.5 ms, and 180 ± 35 ms in Group 2. CONCLUSION: Ritter's method is also effective for optimization of AV intervals among patients with reduced left ventricular function (EF < 35%). The results obtained by RNV correlate well with those from Ritter's method. Individual programming of the AV interval is fundamentally essential in all cases

Holocene Atlantic climate variations deduced from carbonate peri-platform sediments (leeward margin, Great Bahama Bank)

A marine sediment core from the leeward margin of Great Bahama Bank (GBB) was subjected to a multiproxy study. The aragonite dominated core MD992201 comprises the past 7230 years in a decadal time resolution and shows sedimentation rates of up to 13.8 m/kyr. Aragonite mass accumulation rates, age differences between planktonic foraminifera and aragonite sediments, and temperature distribution are used to deduce changes in aragonite production rates and paleocurrent strengths. Aragonite precipitation rates on GBB are controlled by exchange of carbonate ions and CO2 loss due to temperature-salinity conditions and biological activity, and these are dependent on the current strength. Paleocurrent strengths on GBB show high current velocities during the periods 6000–5100 years BP, 3500–2700 years BP, and 1600–700 years BP; lower current speeds existed during the time intervals 5100–3500 years BP, 2700–1600 years BP, and 700–100 years BP. Bahamian surface currents are directly linked to the North Atlantic atmospheric circulation, and thus periods with high (low) current speeds are proposed to be phases of strong (weak) atmospheric circulation

A novel expression cassette delivers efficient production of exclusively tetrameric human butyrylcholinesterase with improved pharmacokinetics for protection against organophosphate poisoning

© 2015 Published by Elsevier B.V. Butyrylcholinesterase is a stoichiometric bioscavenger against poisoning by organophosphorus pesticides and nerve agents. The low level of expression and extremely rapid clearance of monomeric recombinant human butyrylcholinesterase (rhBChE) from bloodstream (t1/2;≈2 min) limits its pharmaceutical application. Recently (Ilyushin at al., PNAS, 2013) we described a long-acting polysialylated recombinant butyrylcholinesterase (rhBChE-CAO), stable in the bloodstream, that protects mice against 4.2 LD50 of VR. Here we report a set of modifications of the initial rhBChE expression vector to improve stability of the enzyme in the bloodstream and increase its production in CHO cells by introducing in the expression cassette: (i) the sequence of the natural human PRAD-peptide in frame with rhBChE gene via "self-processing" viral F2A peptide under control of an hEF/HTLV promoter, and (ii) previously predicted in silico MAR 1-68 and MAR X-29 sequences. This provides fully tetrameric rhBChE (4rhBChE) at 70 mg/l, that displays improved pharmacokinetics (t1/2; = 32 ± 1.2 h, MRT = 43 ± 2 h). 3D Fluorescent visualization and distribution of 125I-labeled enzyme reveals similar low level 4rhBChE and rhBChE-CAO accumulation in muscle, fat, and brain. Administered 4rhBChE was mainly catabolized in the liver and breakdown products were excreted in kidney. Injection of 1.2 LD50 and 1.1 LD50 of paraoxon to BALB/c and knockout BChE-/- mice pre-treated with 4rhBChE (50 mg/kg) resulted in 100% and 78% survival, respectively, without perturbation of long-term behavior. In contrast, 100% mortality of non-pre-treated mice was observed. The high expression level of 4rhBChE in CHO cells permits consideration of this new expression system for manufacturing BChE as a biopharmaceutical

Continuous Flow Reactor for the Production of Stable Amyloid Protein Oligomers

The predominant working hypothesis of Alzheimer's disease is that the proximate pathologic agents are oligomers of the amyloid β-protein (Aβ). "Oligomer" is an ill-defined term. Many different types of oligomers have been reported, and they often exist in rapid equilibrium with monomers and higher-order assemblies. This has made formal structure-activity determinations difficult. Recently, Ono et al. [Ono, K., et al. (2009) Proc. Natl. Acad. Sci. U.S.A. 106, 14745-14750] used rapid, zero-length, in situ chemical cross-linking to stabilize the oligomer state, allowing the isolation and study of pure populations of oligomers of a specific order (number of Aβ monomers per assembly). This approach was successful but highly laborious and time-consuming, precluding general application of the method. To overcome these difficulties, we developed a "continuous flow reactor" with the ability to produce theoretically unlimited quantities of chemically stabilized Aβ oligomers. We show, in addition to its utility for Aβ, that this method can be applied to a wide range of other amyloid-forming proteins

Mechanisms of the noxious inflammatory cycle in cystic fibrosis

Multiple evidences indicate that inflammation is an event occurring prior to infection in patients with cystic fibrosis. The self-perpetuating inflammatory cycle may play a pathogenic part in this disease. The role of the NF-κB pathway in enhanced production of inflammatory mediators is well documented. The pathophysiologic mechanisms through which the intrinsic inflammatory response develops remain unclear. The unfolded mutated protein cystic fibrosis transmembrane conductance regulator (CFTRΔF508), accounting for this pathology, is retained in the endoplasmic reticulum (ER), induces a stress, and modifies calcium homeostasis. Furthermore, CFTR is implicated in the transport of glutathione, the major antioxidant element in cells. CFTR mutations can alter redox homeostasis and induce an oxidative stress. The disturbance of the redox balance may evoke NF-κB activation and, in addition, promote apoptosis. In this review, we examine the hypotheses of the integrated pathogenic processes leading to the intrinsic inflammatory response in cystic fibrosis