Monitoring the T-Cell Receptor Repertoire at Single-Clone Resolution

The adaptive immune system recognizes billions of unique antigens using highly variable T-cell receptors. The αβ T-cell receptor repertoire includes an estimated 10(6) different rearranged β chains per individual. This paper describes a novel micro-array based method that monitors the β chain repertoire with a resolution of a single T-cell clone. These T-arrays are quantitative and detect T-cell clones at a frequency of less than one T cell in a million, which is 2 logs more sensitive than spectratyping (immunoscope), the current standard in repertoire analysis. Using T-arrays we detected CMV-specific CD4+ and CD8+ T-cell clones that expanded early after viral antigen stimulation in vitro and in vivo. This approach will be useful in monitoring individual T-cell clones in diverse experimental settings, and in identification of T-cell clones associated with infectious disease, autoimmune disease and cancer

Arc requires PSD95 for assembly into postsynaptic complexes involved with neural dysfunction and intelligence

Arc is an activity-regulated neuronal protein, but little is known about its interactions, assembly into multiprotein complexes, and role in human disease and cognition. We applied an integrated proteomic and genetic strategy by targeting a tandem affinity purification (TAP) tag and Venus fluorescent protein into the endogenous Arc gene in mice. This allowed biochemical and proteomic characterization of native complexes in wild-type and knockout mice. We identified many Arc-interacting proteins, of which PSD95 was the most abundant. PSD95 was essential for Arc assembly into 1.5-MDa complexes and activity-dependent recruitment to excitatory synapses. Integrating human genetic data with proteomic data showed that Arc-PSD95 complexes are enriched in schizophrenia, intellectual disability, autism, and epilepsy mutations and normal variants in intelligence. We propose that Arc-PSD95 postsynaptic complexes potentially affect human cognitive function

Development of virus-specific CD4(+) T cells during primary cytomegalovirus infection

Although virus-specific CD4(+) T cells have been characterized extensively in latently infected individuals, it is unclear how these protective T-cell responses develop during primary virus infection in humans. Here, we analyzed the kinetics and characteristics of cytomegalovirus-specific (CMV-specific) CD4(+) T cells in the course of primary CMV infection in kidney transplant recipients. Our data reveal that, as the first sign of specific immunity, circulating CMV-specific CD4(+) T cells become detectable with a median of 7 days after first appearance of CMV-DNA in peripheral blood. These cells produce the T helper 1 type (Th1) cytokines IFNγ and TNFα, but not the T helper 2 type (Th2) cytokine IL4. In primary CMV infection, the vast majority of these circulating virus-specific T cells have features of recently activated naive T cells in that they coexpress CD45RA and CD45R0 and appear to be in the cell cycle. In contrast, in people who have recovered from CMV infection earlier in life, virus-specific T cells do not cycle and express surface markers characteristic of memory T cells. After the initial rise, circulating virus-specific CD4(+) T cells decline rapidly. During this phase, a strong rise in IgM and IgG anti-CMV antibody titers occurs, concomitant with the reduction of CMV-DNA in the circulation

Spectratyping and T-array for Jurkat T-cell clone mixed with peripheral blood CD4⁺ T-cells.

<div><p>Jurkat cells were added in different dilutions to a background of peripheral blood CD4⁺ T-cells.</p> <p> <b>(panel A)</b> CDR3 spectratyping with Vβ12-specific primer.</p> <p>The arrow indicates a length identical to 14 amino acids, which is the length of the Jurkat CDR3β.</p> <p> <b>(panel B)</b> A detail of the T-array scans.</p> <p>White arrows indicate hexamer sequence GTTCGG, which is complementary to the first six nucleotides Jurkat NDNβ region.</p> <p> <b>(panel C)</b> Signal intensities of all 4096 spots of the T-array.</p> <p>Black arrows indicate hexamer sequence GTTCGG.</p></div

Clonal expansion of T-cells from a CMV⁺ donor after antigen specific stimulation.

<div><p> <b>(panel A)</b> The fraction of antigen specific T-cell clones determined with NLVPMVATV-loaded tetramers.</p> <p> <b>(panel B)</b> Spectratyping of unsorted Vβ13⁺ and Vβ13⁺/Jβ1-2⁺ fraction.</p> <p> <b>(panel C)</b> CDR3 sequence of the clone identified compared to the Jβ1-2 germline sequence.</p> <p> <b>(panel D)</b> T-array of unsorted Vβ13⁺/Jβ1-2⁺ fraction.</p> <p>The annealer oligonucleotide used in this T-array experiment had the sequence ACTATGGCTACACCTTCGGTT, allowing detection of rearrangements with 3 or less nucleotides deleted from the Jβ1-2 germline.</p> <p>The arrow indicates sequence CCTTTT, the first nucleotides of the NDNβ region of the dominant T-cell clone that was identified in this screen.</p></div

Comparison of the diversity of the human TCRb repertoire and the sensitivity of various methods for repertoire analysis.

<div><p> <b>(A)</b> The human T-cell repertoire contains an estimated 10⁶ rearrangements per individual (<i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Arstila1" target="_blank">ref. 2</a></i>).</p> <p> <b>(B)</b> The sensitivity of Vβ/Cβ immunoscope is approximately 2 in 10⁴ (<i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Hohlfeld1" target="_blank">ref. 15</a> and </i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone-0000055-g003" target="_blank"><i>Fig. 3A</i></a>).</p> <p> <b>(C)</b> Based on the number of Jβ primers, it is estimated that Vβ/Jβ immunoscope is 12-fold more sensitive than Vβ-Cβ immunoscope.</p> <p> <b>(D,E)</b> The sensitivity by which TCR rearrangements are picked by indivual cloning, depends on the number of clones sequenced (<i><a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Betts1" target="_blank">ref. 5</a>–<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone.0000055-Rohrlich1" target="_blank">9</a></i>).</p> <p> <b>(F)</b> The sensitivity of the T-array is approximately 1 in 10⁶ rearrangements (<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0000055#pone-0000055-g003" target="_blank"><i>Fig. 3C</i></a>).</p></div

The T-array protocol.

<div><p> <b>(A)</b> During development, VDJ recombination causes enormous variability in TCRβ chain by randomly selecting different combinations of 23 V, 2 D, and 13 J gene segments, by nucleotide insertion (), and by nucleotide deletion from V (), D, and J () genes.</p> <p>This results in a diversity of an estimated 10⁶ different β chains per individual.</p> <p> <b>(B)</b> N-deletion causes shortening of the Vβ and Jβ segments.</p> <p>The number of nucleotides deleted from Vβ and Jβ germline DNA is limited.</p> <p>N-deletion of 192 published TCRβ mRNAs was determined.</p> <p>The figure shows the cumulative percentage of CDR3βs for the number of nucleotides deleted.</p> <p>TCRβ's with n nucleotides deleted represent approximately 10% of the repertoire if n = 0 to 6, and 5%, if n = 7 to 9.</p> <p> <b>(C)</b> The T-array protocol: <b>(C1)</b> cDNA from T-cells is generated.</p> <p> <b>(C2)</b> CDR3β regions are PCR amplified using biotinylated Vβ-specific () or Vβ-generic primers (not shown here).</p> <p> <b>(C3)</b> Biotinylated strands are removed after alkaline denaturation using streptavidin-coated beads.</p> <p> <b>(c4)</b> Single-strands of polyclonal TCRs are aliquoted and hybridized to fluorescently labeled annealers () complementary to the NDN-adjacent end of a Jβ gene.</p> <p>A specific number of Jβ-gene nucleotides (n) is deleted for each annealer, accounting for N-deletion during the VDJ recombination process.</p> <p>Insert (C4): Each annealer will hybridize to TCRβ rearrangements where n nucleotides are deleted from the Jβ-germline gene segment (<b>C4A</b>) or where less than n nucleotides are deleted (<b>C4B</b>).</p> <p> <b>(C5)</b> The annealer-hybridized fractions are loaded on universal hexamer arrays for <b>(C6)</b> T-cell-clone-specific ligation and, <b>(C7)</b> subsequently washed, scanned and analyzed.</p></div

Ligation experiments with Jurkat CDR3β amplicons.

<div><p> <b>(A)</b> VDJ rearrangement of Jurkat TCRβ.</p> <p>In this CDR3 sequence, there are 3 and 0 nucleotides deleted form the germline Vβ and Jβ, respectively.</p> <p> <b>(B–E)</b> Capillary-electrophoresis chromatograms showing length and signal of fluorescent annealers ().</p> <p> <b>(B)</b> A hexamer (GTTCGG) complementary to the Jurkat 3-end NDN sequence elongated (<b>*</b>) the Jβ1-2-specific annealer (♦).</p> <p> <b>(C)</b> The non-complementary 5′-end hexamer failed to cause elongation.</p> <p>Black peaks: Cy5 signal; Red peaks: FAM signal of size standards.</p> <p> <b>(D, E)</b> Similarly, a Cy5-labeled oligonucleotide complementary to the 3′ coding end of Vβ12, was elongated (<b>*</b>) only in the presence of the hexamer GTCGAG which is complementary to the 5′-end of the NDN sequence.</p> <p> <b>(F)</b> Detail of universal hexamer array after ligation of a Cy5-labeled oligonucleotide complementary to the 5′ coding end of Jβ1-2 in the presence of the antisense strand template of Jurkat CDR3β.</p> <p> <b>(G)</b> Signal intensities of all 4096 spots of the same array experiment.</p> <p>The arrow in (F) and (G) indicates the microarray spot with sequence GTTCGG.</p> <p> <b>(H)</b> List of 20 strongest spots with their hexamer sequence and Cy5-fluorescent signal.</p></div

Snapshots of Catalysis in the E1 Subunit of the Pyruvate Dehydrogenase Multienzyme Complex

The pyruvate dehydrogenase multienzyme assembly (PDH) generates acetyl coenzyme A and reducing equivalents from pyruvate in a multiple-step process that is a nexus of central metabolism. We report crystal structures of the Geobacillus stearothermophilus PDH E1p subunit with ligands that mimic the prereaction complex and the postdecarboxylation product. The structures implicate residues that help to orient substrates, nurture intermediates, and organize surface loops so that they can engage a mobile lipoyl domain that receives the acetyl group and shuttles it to the next active site. The structural and enzymatic data suggest that H128β performs a dual role: first, as electrostatic catalyst of the reaction of pyruvate with the thiamine cofactor; and second, as a proton donor in the second reaction of acetyl group with the lipoate. We also identify I206α as a key residue in mediating the conformation of active-site loops. We propose that a simple conformational flip of the H271α side chain assists transfer of the acetyl group from thiamine cofactor to lipoyl domain in synchrony with reduction of the dithiolane ring