Warm seawater temperature promotes substrate colonization by the blue coral, Heliopora coerulea

Background: Heliopora coerulea, the blue coral, is a reef building octocoral that is reported to have a higher optimum temperature for growth compared to most scleractinian corals. This octocoral has been observed to grow over both live and dead scleractinians and to dominate certain reefs in the Indo-Pacific region. The molecular mechanisms underlying the ability of H. coerulea to tolerate warmer seawater temperatures and to effectively compete for space on the substrate remain to be elucidated. Methods: In this study, we subjected H. coerulea colonies to various temperatures for up to 3 weeks. The growth and photosynthetic efficiency rates of the coral colonies were measured. We then conducted pairwise comparisons of gene expression among the different coral tissue regions to identify genes and pathways that are expressed under different temperature conditions. Results: A horizontal growth rate of 1.13 +/- 0.25 mm per week was observed for corals subjected to 28 or 31 degrees C. This growth rate was significantly higher compared to corals exposed at 26 degrees C. This new growth was characterized by the extension of whitish tissue at the edges of the colony and was enriched for a matrix metallopeptidase, a calcium and integrin binding protein, and other transcripts with unknown function. Tissues at the growth margin and the adjacent calcified encrusting region were enriched for transcripts related to proline and riboflavin metabolism, nitrogen utilization, and organic cation transport. The calcified digitate regions, on the other hand, were enriched for transcripts encoding proteins involved in cell-matrix adhesion, translation, receptor-mediated endocytosis, photosynthesis, and ion transport. Functions related to lipid biosynthesis, extracellular matrix formation, cell migration, and oxidation-reduction processes were enriched at the growth margin in corals subjected for 3 weeks to 28 or 31 degrees C relative to corals at 26 degrees C. In the digitate region of the coral, transcripts encoding proteins that protect against oxidative stress, modify cell membrane composition, and mediate intercellular signaling pathways were enriched after just 24 h of exposure to 31 degrees C compared to corals at 28 degrees C. The overall downregulation of gene expression observed after 3 weeks of sustained exposure to 31 degrees C is likely compensated by symbiont metabolism. Discussion: These findings reveal that the different regions of H. coerulea have variable gene expression profiles and responses to temperature variation. Under warmer conditions, the blue coral invests cellular resources toward extracellular matrix formation and cellular migration at the colony margins, which may promote rapid tissue growth and extension. This mechanism enables the coral to colonize adjacent reef substrates and successfully overgrow slower growing scleractinian corals that may already be more vulnerable to warming ocean waters

Influence of the Blue Coral Heliopora coerulea on Scleractinian Coral Larval Recruitment

The octocoral Heliopora coerulea has emerged as one of the most dominant reef-building corals in the Bolinao Reef Complex, northern Philippines. One of the possible mechanisms that may contribute to the success of H. coerulea over scleractinian corals is its ability to compete effectively for space on the reef by inhibiting the settlement of coral larvae in its immediate vicinity. To determine whether H. coerulea can indeed inhibit larval recruitment, settlement tiles were deployed inside H. coerulea aggregations or on hard substrate at a distance of about 2 to 3 meters away. After three months of deployment, only a single H. coerulea recruit was observed on tiles placed within aggregations whereas many different coral recruits were observed on tiles placed on substrate away from the blue coral. These results suggest that adult H. coerulea can inhibit the settlement of scleractinian larvae. This effect may be mediated by various mechanisms, such as the production of allelopathic compounds, deployment of mesenterial filaments, and sweeper tentacles. However, further studies are needed to determine the modes of competition that are used by the coral

Influence of the Blue Coral Heliopora coerulea

The octocoral Heliopora coerulea has emerged as one of the most dominant reef-building corals in the Bolinao Reef Complex, northern Philippines. One of the possible mechanisms that may contribute to the success of H. coerulea over scleractinian corals is its ability to compete effectively for space on the reef by inhibiting the settlement of coral larvae in its immediate vicinity. To determine whether H. coerulea can indeed inhibit larval recruitment, settlement tiles were deployed inside H. coerulea aggregations or on hard substrate at a distance of about 2 to 3 meters away. After three months of deployment, only a single H. coerulea recruit was observed on tiles placed within aggregations whereas many different coral recruits were observed on tiles placed on substrate away from the blue coral. These results suggest that adult H. coerulea can inhibit the settlement of scleractinian larvae. This effect may be mediated by various mechanisms, such as the production of allelopathic compounds, deployment of mesenterial filaments, and sweeper tentacles. However, further studies are needed to determine the modes of competition that are used by the coral

Transcriptome analysis of the reef-building octocoral, Heliopora coerulea

The blue coral, Heliopora coerulea, is a reef-building octocoral that prefers shallow water and exhibits optimal growth at a temperature close to that which causes bleaching in scleractinian corals. To better understand the molecular mechanisms underlying its biology and ecology, we generated a reference transcriptome for H. coerulea using next-generation sequencing. Metatranscriptome assembly yielded 90,817 sequences of which 71% (64,610) could be annotated by comparison to public databases. The assembly included transcript sequences from both the coral host and its symbionts, which are related to the thermotolerant C3-Gulf ITS2 type Symbiodinium. Analysis of the blue coral transcriptome revealed enrichment of genes involved in stress response, including heat-shock proteins and antioxidants, as well as genes participating in signal transduction and stimulus response. Furthermore, the blue coral possesses homologs of biomineralization genes found in other corals and may use a biomineralization strategy similar to that of scleractinians to build its massive aragonite skeleton. These findings thus offer insights into the ecology of H. coerulea and suggest gene networks that may govern its interactions with its environment

Beliefs and practices about reproductive tract infections: Findings from a series of Philippine FGDs

The past decade has been characterized by increasing concern about the medical, social, and economic problems associated with reproductive tract infections (RTIs). The goal of preventing and curing RTIs is now being prioritized by public health agencies in the developing world. Very little research has been conducted on the problem of RTIs in the local context, and it would be helpful for program managers if the knowledge and beliefs now being held about RTIs were more clearly delineated. Knowing more about the way in which these illnesses are viewed by the community, about traditional practices for preventing and curing RTIs, and about the results of ongoing public health initiatives designed to deal with these conditions is also needed. The present study, as this report states, utilizes a qualitative research technique known as focus group discussions as a means of stimulating people to speak up on this subject. While the study won’t provide precise statistical profiles of study respondents, it should allow a first-hand glimpse of the ways in which RTIs are perceived and responded to by a group of typical Filipinos

Moral expansiveness around the world:The role of societal factors across 36 countries

International audienceWhat are the things that we think matter morally, and how do societal factors influence this? To date, research has explored several individual-level and historical factors that influence the size of our ‘moral circles.' There has, however, been less attention focused on which societal factors play a role. We present the first multi-national exploration of moral expansiveness—that is, the size of people’s moral circles across countries. We found low generalized trust, greater perceptions of a breakdown in the social fabric of society, and greater perceived economic inequality were associated with smaller moral circles. Generalized trust also helped explain the effects of perceived inequality on lower levels of moral inclusiveness. Other inequality indicators (i.e., Gini coefficients) were, however, unrelated to moral expansiveness. These findings suggest that societal factors, especially those associated with generalized trust, may influence the size of our moral circles

Happiness around the world: A combined etic-emic approach across 63 countries.

What does it mean to be happy? The vast majority of cross-cultural studies on happiness have employed a Western-origin, or "WEIRD" measure of happiness that conceptualizes it as a self-centered (or "independent"), high-arousal emotion. However, research from Eastern cultures, particularly Japan, conceptualizes happiness as including an interpersonal aspect emphasizing harmony and connectedness to others. Following a combined emic-etic approach (Cheung, van de Vijver & Leong, 2011), we assessed the cross-cultural applicability of a measure of independent happiness developed in the US (Subjective Happiness Scale; Lyubomirsky & Lepper, 1999) and a measure of interdependent happiness developed in Japan (Interdependent Happiness Scale; Hitokoto & Uchida, 2015), with data from 63 countries representing 7 sociocultural regions. Results indicate that the schema of independent happiness was more coherent in more WEIRD countries. In contrast, the coherence of interdependent happiness was unrelated to a country's "WEIRD-ness." Reliabilities of both happiness measures were lowest in African and Middle Eastern countries, suggesting these two conceptualizations of happiness may not be globally comprehensive. Overall, while the two measures had many similar correlates and properties, the self-focused concept of independent happiness is "WEIRD-er" than interdependent happiness, suggesting cross-cultural researchers should attend to both conceptualizations

Gene networks governing the response of a calcareous sponge to future ocean conditions reveal lineage‐specific XBP1 regulation of the unfolded protein response

Abstract Marine sponges are predicted to be winners in the future ocean due to their exemplary adaptive capacity. However, while many sponge groups exhibit tolerance to a wide range of environmental insults, calcifying sponges may be more susceptible to thermo‐acidic stress. To describe the gene regulatory networks that govern the stress response of the calcareous sponge, Leucetta chagosensis (class Calcarea, order Clathrinida), individuals were subjected to warming and acidification conditions based on the climate models for 2100. Transcriptome analysis and gene co‐expression network reconstruction revealed that the unfolded protein response (UPR) was activated under thermo‐acidic stress. Among the upregulated genes were two lineage‐specific homologs of X‐box binding protein 1 (XBP1), a transcription factor that activates the UPR. Alternative dimerization between these XBP1 gene products suggests a clathrinid‐specific mechanism to reversibly sequester the transcription factor into an inactive form, enabling the rapid regulation of pathways linked to the UPR in clathrinid calcareous sponges. Our findings support the idea that transcription factor duplication events may refine evolutionarily conserved molecular pathways and contribute to ecological success

Gene expression analysis

Differentially expressed genes were identified using the edgeR (Robinson, et al. 569 2010) package in R. Genes were considered differentially expressed if upregulation or downregulation was ≥ 4-fold relative to the controls with a False Discovery Rate (FDR) ≤ 0.05. Pairwise comparisons were conducted between the Present Day samples and samples subjected to the other treatments.Gene co-expression networks were reconstructed using rlog-transformed expected counts through WGCNA (Langfelder and Horvath 2008) implemented in R. Hub genes (gene significance > |0.2|; module membership > |0.8|) within a module were identified and used in downstream analyses.Pfam and GO enrichment analyses for DEGs and module members were performed using a script (github.com/fle1/canolab_scripts/blob/master/Pfam_enrichment.R) and the topGO package (Alexa and Rahnenführer 2009) implemented in R. Pfam domains and GO terms with p-value Blastp top hits for each hub gene were used as input in the KEGG pathway enrichment analysis (score > 0.400 and FDR < 0.01) in STRING v.11 (Mering, et al. 614 2003). Relative expression of sponge gene homologs in RCP 8.5 relative to the Present Day control was computed as the average sum of transcripts per million (TPM).</p

LchaXBP1 homologs sequencing and quantitation

Total RNA was extracted from tissues of sponge individuals exposed to Present Day control and RCP 8.5 treatments (n=3 per treatment) using TRIzol reagent (Invitrogen). Contaminating DNA was removed using the TURBO DNA-free Kit (Invitrogen). cDNA synthesis was carried out using the GoScript™ Reverse Transcriptase kit (Promega).Primers were designed to target the full-length and the bZIP domain of the two XBP1 homologs, as well as the β-tubulin gene (endogenous control for qPCR) in L. chagosensis.Full-length and bZIP domain of LcXBP1 genes were amplified from the prepared cDNA using the following primers: LcXBP1_1 (F: 5’-GTTCGTGTTGTAGTTGTAGAGTAG-3’; R: 5’- TTATTTGGCCGCATTCATTTACAC -3’), LcXBP1_2 (F: 5’-CATTAGCCAGAGCGTTGGATTGTC-3’; R: 5’-AGATCCCTTCATCCTCTTCCGAATTC-3’), LcbZIP2650 (F: 5’-CGAGAAGCTTGACCACCTGT-3’; R: 5’-TCTGTCTTACCCCTCCTTGC-3’), and LcbZIP60042 (F:5’-CCTGAAAAGTATCGGCCGAG-3’; R: 5’-GTGAGGCTGGCAATGTTGAA-3’). Amplified samples were viewed through agarose gel electrophoresis to confirm amplicon size and were sent to Macrogen, South Korea for Sanger sequencing. Trimmed and aligned sequences were deposited to Genbank under the accession numbers: PP716769 (LcXBP1_1), PP627506 (LcXBP1_2), PP627507 (LcbZIP2650), and PP627508 (LcbZIP60042).Expression levels of the two XBP1 homologs in L. chagosensis under the Present Day and RCP 8.5 treatments were quantified using the bZIP primers through QuantStudio™ 3 Real-Time PCR system (Thermo Fisher Scientific). qPCR reactions included 40 cycles of activation at 95°C for 2 min, denaturation at 95°C for 15 sec, and annealing/elongation at 55°C for 1 min. Each reaction contained 10 μl of 2 × GoTaq® qPCR Master Mix (Promega), 0.2 μl each of 100 μM forward and reverse primers, 4 μl template cDNA, and 5.6 μl nuclease-free H2O. Three biological replicates and three technical replicates were used in the quantitation of each gene alongside negative controls. Primer efficiency and primer specificity were assessed using the dilution curves and melt curves, respectively. The abundance of target transcripts was computed using the ddCt and Pfaffl methods. Target transcript abundances were normalized to β-tubulin as a reference gene.</p