2,395 research outputs found
Computer simulation of the microstructure and rheology of semi-solid alloys under shear
The rheological behavior of metallic alloys containing both solid and liquid
phases is investigated in the low solid fraction range (<50%). This behavior
depends on both the solid fraction and the shear rate. The concept of Effective
Volume Fraction (EVF) is used to decorrelate the influence of these two
parameters. At high shear rate the slurry behaves like a suspension of hard
spheres, whereas at lower shear rate, particles tend to aggregate in clusters,
entrapping liquid and thus, increasing the EVF and the viscosity. A lattice
model is introduced to simulate the aggregation / break-up processes within a
slurry under shear. When the steady state is reached, the entrapped liquid
fraction is calculated, leading to a viscosity estimation. Simulation results
for the viscosity and 3D cluster structure are in good agreement with
experimental results.Comment: 30 pages, 17 figures, to be published in Acta Mate
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe
Effects of ionizing radiation on charge-coupled imagers
The effects of ionizing radiation on three different charge coupled imagers have been investigated. Device performance was evaluated as a function of total gamma ray dose. The principal failure mechanisms have been identified for each particular device structure. The clock and bias voltages required for high total dose operation of the devices are presented
Essais d'épuration des eaux usées de Marrakech par la jacinthe d'eau (Charges organique, bactérienne et parasitologique)
Cette étude est destinée à tester expérimentalement les capacités d'épuration des eaux usées par lagunage à macrophytes (jacinthe d'eau : Eichhornia crassipes), sous les conditions climatiques de Marrakech.L'installation fonctionne en continu avec un débit constant à l'entrée de 10 l/min. La charge admise est de 40 g DCO/M2/j.Sous l'aspect de la production de biomasse végétale, les effluents domestiques constituent un bon substrat nutritionnel. Les taux de croissance et les productions obtenues montrent dans l'ensemble une excellent adaptation d'Eichhornia crassipesà ce milieu. Le maximum de biomasse et de productivité ont été obtenu en période estivale et sont respectivement de: 40 kg MF/m2 et 38,6 MS/m2/j. Il s'est avéré également que la jacinthe d'eau est persistante toute l'année sous le climat méditerranéen aride de Marrakech.L'épuration des eaux usées domestiques par lagunage à macrophyles aboutit à des rendements satisfaisants surtout en période estivale où on obtient un abattement de 87 % de la DCO et une réduction de 95 % des MEST.Sur te plan sanitaire, l'abattement de la charge bactérienne exprimée par les bactéries témoins de contamination fécale peut atteindre jusqu'à 2ULog pour un temps de séjour théorique très court (7 jours).Ce système e par ailleurs fourni des abattement de 100 % des oeufs d'helminthes parasites au niveau de l'eau épurée.The aim of the present study is to experimentaly test the capacities of the mater hyacinth (Eichhornia crassipes) in order to purify wastewater under Manakesh climatic conditions.The experiment was carried al wastewater spreading zone of Marrakesh pretraitement.The experimant's installation is made of two lined water yacinth ponds that receive domestic wastewater.The proposed process is a continuous system with a constant flow rate of 10 l/mn. The theoritical retention time was estimated to 7 days. The allowed load is 40 g COD/m2/day. Macrophytic biomass was observed for both ponds during the experimental period (Match, 1986 - February, 1987). Parameters of organic, bacterial and parasitological loads are studied in order to determine the system efficiency under arid climate.Obtained results show the water hyacinth ability to adapt to Marrakesh climatic conditions. The number of plants doubled at 12 days, this is coherent with results obtained by PENFOUND (1956), BOCK (1969), WESTLAKE (1963, 1975) and SCULTHORPE (1967). Maximum biomass level and productivity were achieved during the summer period : 40 kg WW/m2/day and 38,6 g DW/m2/day respectively. Biomass and productivity obtained under arid climate are similar to results obtained by WOOTEN and DODD (1976), and by DINGES (1976) under subtropical conditions, and higher than chose obtained by JOHN (1985) under temperate climate. The growth period of water hyacinth is estimated to 9 months at Marrakesh, 10 months at subtropical climate (WOLVERTON and MC DONALD, 1976) and limited to 6 months under cold climate (COPELLI et al., 1982; DUBOIS, 1983; SAUZE, 1983; DE CASABIANCA, 1985). Temperature is considered as a limited growth factor of water yacinth. According to FRANCOIS et al. (1977), the water hyacinth growth was stopped when the temperature is lower than 10 °C. Linder Marrakesh arid climate, the temperature is always higher than 10 °C. It was also found that the water hyacinth survive all a year around in the arid climate of Marrakesh.Domestic sewage purification by water hyacinth leads to satisfactory efficiency during the summer concerning reduction of COD: 87 % and TSS : 95 %. This phenomenon may be jointed to the retention time wich was lengthed (9,4 days) in the summer, and the higher biomass density of water hyacinths in this one. The purifying action of floating macrophytes (Eichharnia crassipes) is physical and biological. The root system stabilizes the medium thus favoring sedimentation of TSS and particulate COD both on the bottom of the tank and by trapping in the root hairs. Elimination of COD is realized by means of the action of bacteria which are present, by sedimentation of particulate COD and root filtration.The biological action of the plants is not an important mechanism for COD elimination. The system efficiency is low at the winter and the reduction of COD and TSS have not exceed 60 % and 82 % respectively because the degenering of the water hyacinths.From sanitary point of view, bacterial load reduction expressed by control faecal contamination bacteria achieved 2 log Units for a short theoritical retention time (7 days). This is higher than the result obtained by DUBOIS (1985). Two hypothesis are given to explain reduction of bacterial load by water hyacinths :1) the bacteria are sedimented or trapped in the root hairs of the water hyacinths whith TSS. 2) Water hyacinths may have a capacity to secrete a chemical substance wich could have bactericid or bacteriostatic effect. The improvement of retention time and the addition of one or two supplementary ponds will probably lead to better results. Moreover, this process had also reduced parasitical helminth eggs to undetectable levels (100 %). The parasitical helminth eggs distinguisched at domestic sewage received by the experimental installation, are Taenia, Hymenolepis, Trichuris and Ascaris geints. Their total number vary tram 0 to 120 eggs/l with a mean of 32. Other types of eggs could be encountred generally in waste water as : Toxocara, Oxyure, Capillaria and Taxoascaris (FOX and FITZGERALD,1976) but was not detected by our technique. No helminth eggs were found in purified wastewater descended through water hyacinth ponds. This phenomenon is explained by supposing that the helminth eggs are present in the effluent but it was the detection limit of the employed technique (Bailenger method), or there is no eggs really at the effluent because of their higher specific weight. Ascaris, Taenia and Trichuris eggs have a sedimentation rate of 0,65 m/h, 0,26 m/h and 1,5 m/h respectively (FEACHEM et al.,1983). The eggs sedimented rapidly in the water hyacinths ponds involving a transfer of the effluent pollution to the sediment. Several authors affirmed that the stabilization ponds are an effective means to reduce parasitical helminth eggs of the wastewaters (GLOYNA, 1972; KOWAL, 1985). Hence, if the parasitical risk could be controled in the purified water (effluent), particular attention should be given to sediments. It is also important to point out, that no parasitical nematode is found at the influent. Nematofauna associated to wastewater and roots of water hyacinth, was represented by bacteria consumer nematode. The abundance of nematode is definite by the existence of bacterial food in the wastewaters (CALAWAY, 1963; SHIEMER, 1976). The principal genus determined are Rhabditis sp, Plectus sp. and Mononchoïdes sp. It appears that Rhabditis genus, is dominant in the first pond (94,7 %) of the nematode population. However, the two genus Rhabditis sp. and Plectus sp. are dominant in the second one and represent 50 % and 49 % respectively. The presence of Plectidae in the second basin indicates that is less loaded (ZULINI, 1976). However, under the arid climate conditions of Marrakesh, the process based on water hyacinth for wastewater purification, is faced with two major problems : first, the water loss by evapotranspiration reachs 60 % during the summer time under arid climate of Marrakesh. The development of Mousquito particularly in the summer, constitutes the second problem of our proposed process. Moreover, front economical point of view, the water hyacinths show a good productivity in the summer under arid climate and could be exploited in several field
Late harvest as factor affecting esca and Botryosphaeria dieback prevalence of vineyards in the Alsace region of France
The decline of grapevines due to esca and Botryosphaeria dieback (Bot. dieback) is a serious problem in the Alsace region of France. A survey of 82 vineyards over 8 years showed that among a set of agronomical and cultural variables, esca and Bot. dieback prevalence correlated to the harvest dates, especially late harvest dates for the production of sweet wines. The interpretation of this finding that points to the carbon balance of the vine and its reserves status as possible causation is discussed. Under this hypothesis the data also point to climatic variables as factors in the disease epidemiology, with a lag phase of about one year.
Task based profiles of language impairment in Parkinson’s Disease
This study aimed to add to our understanding of language impairment in people with Parkinson's Disease (PwPD). Language difficulties are increasingly reported in PD. However, there are contradictory reports on how they relate to motor and cognitive impairment. In addition, the link between various language deficits or the same deficits across task modalities is not well understood. This lack of understanding impacts on clinicians’ ability to assess and effectively treat language impairment in PD. Our study therefore aimed to investigate language performance across a number of task structures and correlate this performance with cognitive skills, as well as motor and speech performance. The study included 22 German speaking PwPD and 22 matched healthy control participants. 18 participants in each group were cognitively healthy and four had mild cognitive impairment. They performed a number of executive function and language tasks of different complexity and structure. The linguistic investigation focused on grammatical accuracy and complexity, linguistic content as well as articulatory features. There were few cognitive differences between the two groups, with only set-shifting as an executive function being significantly reduced in PwPD, but grammatical error rate was higher in PwPD than in their healthy controls across all language tasks. This was linked to set shifting skills but only for the complex grammar condition, not for more naturalistic language tasks. Furthermore, there was no correlation of language performance across the task levels, i.e. error rates in the structured task did not predict naturalistic performance. Motor and dysarthria severity could not predict language impairment either. This study confirms the presence of language problems in PwPD in the absence of global cognitive impairment or only MCI, and at the same time establishes a task based relationship between the two skills. From a clinical perspective the data indicate that structured tests are unable to accurately predict naturalistic language performance, highlighting the need for functional assessments rather than relying on fast scoring structured tests, at least at early disease stages. In addition, the impact of the individual language difficulties needs to be explored to establish appropriate and effective treatment pathways
Prevalence and diversity of Chlamydiales and other amoeba-resisting bacteria in domestic drinking water systems.
A growing number of human infections incriminate environmental bacteria that have evolved virulent mechanisms to resist amoebae and use them as a replicative niche. These bacteria are designated amoeba-resisting bacteria (ARB). Despite the isolation of these ARB in various human clinical samples, the possible source of infection remains undetermined in most cases. However, it is known that the ARB Legionella pneumophila, for instance, causes a respiratory infection in susceptible hosts after inhalation of contaminated water aerosols from various sources. The Chlamydiales order contains many ARB, such as Parachlamydia acanthamoebae or Simkania negevensis, previously implicated in human respiratory infections with no identified contamination sources. We thus investigated whether domestic water systems are a potential source of transmission of these Chlamydiales to humans by using amoebal culture and molecular methods. Other important ARB such as mycobacteria and Legionella were also investigated, as were their possible amoebal hosts. This work reports for the first time a very high prevalence and diversity of Chlamydiales in drinking water, being detected in 35 (72.9%) of 48 investigated domestic water systems, with members of the Parachlamydiaceae family being dominantly detected. Furthermore, various Legionella and mycobacteria species were also recovered, some species of which are known to be causal agents of human infections
Development of a new chlamydiales-specific real-time PCR and its application to respiratory clinical samples.
Originally composed of the single family Chlamydiaceae, the Chlamydiales order has extended considerably over the last several decades. Chlamydia-related bacteria were added and classified into six different families and family-level lineages: the Criblamydiaceae, Parachlamydiaceae, Piscichlamydiaceae, Rhabdochlamydiaceae, Simkaniaceae, and Waddliaceae. While several members of the Chlamydiaceae family are known pathogens, recent studies showed diverse associations of Chlamydia-related bacteria with human and animal infections. Some of these latter bacteria might be of medical importance since, given their ability to replicate in free-living amoebae, they may also replicate efficiently in other phagocytic cells, including cells of the innate immune system. Thus, a new Chlamydiales-specific real-time PCR targeting the conserved 16S rRNA gene was developed. This new molecular tool can detect at least five DNA copies and show very high specificity without cross-amplification from other bacterial clade DNA. The new PCR was validated with 128 clinical samples positive or negative for Chlamydia trachomatis or C. pneumoniae. Of 65 positive samples, 61 (93.8%) were found to be positive with the new PCR. The four discordant samples, retested with the original test, were determined to be negative or below detection limits. Then, the new PCR was applied to 422 nasopharyngeal swabs taken from children with or without pneumonia; a total of 48 (11.4%) samples were determined to be positive, and 45 of these were successfully sequenced. The majority of the sequences corresponded to Chlamydia-related bacteria and especially to members of the Parachlamydiaceae family
Undressing of Waddlia chondrophila to enrich its outer membrane proteins to develop a new species-specific ELISA.
Waddlia chondrophila, an obligate intracellular bacterium of the Chlamydiales order, is considered as an agent of bovine abortion and a likely cause of miscarriage in humans. Its role in respiratory diseases was questioned after the detection of its DNA in clinical samples taken from patients suffering from pneumonia or bronchiolitis. To better define the role of Waddlia in both miscarriage and pneumonia, a tool allowing large-scale serological investigations of Waddlia seropositivity is needed. Therefore, enriched outer membrane proteins of W. chondrophila were used as antigens to develop a specific ELISA. After thorough analytical optimization, the ELISA was validated by comparison with micro-immunofluorescence and it showed a sensitivity above 85% with 100% specificity. The ELISA was subsequently applied to human sera to specify the role of W. chondrophila in pneumonia. Overall, 3.6% of children showed antibody reactivity against W. chondrophila but no significant difference was observed between children with and without pneumonia. Proteomic analyses were then performed using mass spectrometry, highlighting members of the outer membrane protein family as the dominant proteins. The major Waddlia putative immunogenic proteins were identified by immunoblot using positive and negative human sera. The new ELISA represents an efficient tool with high throughput applications. Although no association with pneumonia and Waddlia seropositivity was observed, this ELISA could be used to specify the role of W. chondrophila in miscarriage and in other diseases
- …