TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Analysis of Neighbourhoods in Multi-layered Dynamic Social Networks

Social networks existing among employees, customers or users of various IT systems have become one of the research areas of growing importance. A social network consists of nodes - social entities and edges linking pairs of nodes. In regular, one-layered social networks, two nodes - i.e. people are connected with a single edge whereas in the multi-layered social networks, there may be many links of different types for a pair of nodes. Nowadays data about people and their interactions, which exists in all social media, provides information about many different types of relationships within one network. Analysing this data one can obtain knowledge not only about the structure and characteristics of the network but also gain understanding about semantic of human relations. Are they direct or not? Do people tend to sustain single or multiple relations with a given person? What types of communication is the most important for them? Answers to these and more questions enable us to draw conclusions about semantic of human interactions. Unfortunately, most of the methods used for social network analysis (SNA) may be applied only to one-layered social networks. Thus, some new structural measures for multi-layered social networks are proposed in the paper, in particular: cross-layer clustering coefficient, cross-layer degree centrality and various versions of multi-layered degree centralities. Authors also investigated the dynamics of multi-layered neighbourhood for five different layers within the social network. The evaluation of the presented concepts on the real-world dataset is presented. The measures proposed in the paper may directly be used to various methods for collective classification, in which nodes are assigned to labels according to their structural input features.Comment: 16 pages, International Journal of Computational Intelligence System

The Cesàro operator on Korenblum type spaces of analytic functions

[EN] The spectrum of the CesA ro operator , which is always continuous (but never compact) when acting on the classical Korenblum space and other related weighted Fr,chet or (LB) spaces of analytic functions on the open unit disc, is completely determined. It turns out that such spaces are always Schwartz but, with the exception of the Korenblum space, never nuclear. Some consequences concerning the mean ergodicity of are deduced.The research of the first two authors was partially supported by the projects MTM2013-43540-P and MTM2016-76647-P. The second author gratefully acknowledges the support of the Alexander von Humboldt Foundation.Albanese, A.; Bonet Solves, JA.; Ricker, WJ. (2018). The Cesàro operator on Korenblum type spaces of analytic functions. Collectanea mathematica. 69(2):263-281. https://doi.org/10.1007/s13348-017-0205-7S263281692Albanese, A.A., Bonet, J., Ricker, W.J.: Mean ergodic operators in Fréchet spaces. Ann. Acad. Sci. Fenn. Math. 34, 401–436 (2009)Albanese, A.A., Bonet, J., Ricker, W.J.: Montel resolvents and uniformly mean ergodic semigroups of linear operators. Quaest. Math. 36, 253–290 (2013)Albanese, A.A., Bonet, J., Ricker, W.J.: The Cesàro operator in growth Banach spaces of analytic functions. Integral Equ. Oper. Theory 86, 97–112 (2016)Albanese, A.A., Bonet, J., Ricker, W.J.: The Cesàro operator in the Fréchet spaces $$\ell ^{p+}$$ ℓ p + and $$L^{p-}$$ L p - . Glasgow Math. J. 59, 273–287 (2017)Albanese, A.A., Bonet, J., Ricker, W.J.: The Cesàro operator on power series spaces. Stud. Math. doi: 10.4064/sm8590-2-2017Aleman, A.: A class of integral operators on spaces of analytic functions, In: Proceedings of the Winter School in Operator Theory and Complex Analysis, Univ. Málaga Secr. Publ., Málaga, pp. 3–30 (2007)Aleman, A., Constantin, O.: Spectra of integration operators on weighted Bergman spaces. J. Anal. Math. 109, 199–231 (2009)Aleman, A., Peláez, J.A.: Spectra of integration operators and weighted square functions. Indiana Univ. Math. J. 61, 1–19 (2012)Aleman, A., Persson, A.-M.: Resolvent estimates and decomposable extensions of generalized Cesàro operators. J. Funct. Anal. 258, 67–98 (2010)Aleman, A., Siskakis, A.G.: An integral operator on $$H^p$$ H p . Complex Var. Theory Appl. 28, 149–158 (1995)Aleman, A., Siskakis, A.G.: Integration operators on Bergman spaces. Indiana Univ. Math. J. 46, 337–356 (1997)Barrett, D.E.: Duality between $$A^\infty$$ A ∞ and $$A^{- \infty }$$ A - ∞ on domains with nondegenerate corners, Multivariable operator theory (Seattle, WA, 1993), pp. 77–87, Contemporary Math. Vol. 185, Amer. Math. Soc., Providence (1995)Bierstedt, K.D., Bonet, J., Galbis, A.: Weighted spaces of holomorphic functions on bounded domains. Mich. Math. J. 40, 271–297 (1993)Bierstedt, K.D., Bonet, J., Taskinen, J.: Associated weights and spaces of holomorphic functions. Stud. Math. 127, 137–168 (1998)Bierstedt, K.D., Meise, R., Summers, W.H.: A projective description of weighted inductive limits. Trans. Am. Math. Soc. 272, 107–160 (1982)Bierstedt, K.D., Summers, W.H.: Biduals of weighted Banach spaces of analytic functions. J. Aust. Math. Soc. (Ser. A) 54, 70–79 (1993)Bonet, J., Domański, P., Lindström, M., Taskinen, J.: Composition operators between weighted Banach spaces of analytic functions. J. Aust. Math. Soc. (Ser. A) 64, 101–118 (1998)Diestel, J., Jarchow, H., Tonge, A.: Absolutely Summing Operators. Cambridge University Press, Cambridge (1995)Domenig, T.: Composition operators on weighted Bergman spaces and Hardy spaces. Atomic Decompositions and Diagonal Operators, Ph.D. Thesis, University of Zürich (1997). [Zbl 0909.47025]Domenig, T.: Composition operators belonging to operator ideals. J. Math. Anal. Appl. 237, 327–349 (1999)Dunford, N., Schwartz, J.T.: Linear Operators I: General Theory. 2nd Printing. Wiley Interscience Publ., New York (1964)Edwards, R.E.: Functional Analysis. Theory and Applications. Holt, Rinehart and Winston, New York, Chicago San Francisco (1965)Grothendieck, A.: Topological Vector Spaces. Gordon and Breach, London (1973)Hedenmalm, H., Korenblum, B., Zhu, K.: Theory of Bergman Spaces. Graduate Texts in Mathematics, vol. 199. Springer, New York (2000)Jarchow, H.: Locally Convex Spaces. Teubner, Stuttgart (1981)Korenblum, B.: An extension of the Nevanlinna theory. Acta Math. 135, 187–219 (1975)Krengel, U.: Ergodic Theorems. de Gruyter Studies in Mathematics, vol. 6. Walter de Gruyter Co., Berlin (1985)Lusky, W.: On the isomorphism classes of weighted spaces of harmonic and holomorphic functions. Stud. Math. 175(1), 19–40 (2006)Meise, R., Vogt, D.: Introduction to Functional Analysis. Clarendon Press, Oxford (1997)Melikhov, S.N.: (DFS )-spaces of holomorphic functions invariant under differentiation. J. Math. Anal. Appl. 297, 577–586 (2004)Persson, A.-M.: On the spectrum of the Cesàro operator on spaces of analytic functions. J. Math. Anal Appl. 340, 1180–1203 (2008)Pietsch, A.: Nuclear Locally Convex Spaces. Springer, Berlin (1972)Shields, A.L., Williams, D.L.: Bounded projections, duality and multipliers in spaces of analytic functions. Trans. Am. Math. Soc. 162, 287–302 (1971)Siskakis, A.: Volterra operators on spaces of analytic functions—a survey. In: Proceedings of the First Advanced Course in Operator Theory and Complex Analysis, Univ. Sevilla Serc. Publ., Seville, pp. 51–68 (2006

Electron spin resonance of nitrogen-vacancy centers in optically trapped nanodiamonds

Using an optical tweezers apparatus, we demonstrate three-dimensional control of nanodiamonds in solution with simultaneous readout of ground-state electron-spin resonance (ESR) transitions in an ensemble of diamond nitrogen-vacancy (NV) color centers. Despite the motion and random orientation of NV centers suspended in the optical trap, we observe distinct peaks in the measured ESR spectra qualitatively similar to the same measurement in bulk. Accounting for the random dynamics, we model the ESR spectra observed in an externally applied magnetic field to enable d.c. magnetometry in solution. We estimate the d.c. magnetic field sensitivity based on variations in ESR line shapes to be ~50 microTesla/Hz^1/2. This technique may provide a pathway for spin-based magnetic, electric, and thermal sensing in fluidic environments and biophysical systems inaccessible to existing scanning probe techniques.Comment: 29 pages, 13 figures for manuscript and supporting informatio

The Cesàro operator in growth Banach spaces of analytic functions

[EN] The CesA ro operator C, when acting in the classical growth Banach spaces and , for , of analytic functions on , is investigated. Based on a detailed knowledge of their spectra (due to A. Aleman and A.-M. Persson) we are able to determine the norms of these operators precisely. It is then possible to characterize the mean ergodic and related properties of C acting in these spaces. In addition, we determine the largest Banach space of analytic functions on which C maps into (resp. into ); this optimal domain space always contains (resp. ) as a proper subspace.The research of the first two authors was partially supported by the projects MTM2013-43540-P and GVA Prometeo II/2013/013.Albanese, A.; Bonet Solves, JA.; Ricker, WJ. (2016). The Cesàro operator in growth Banach spaces of analytic functions. Integral Equations and Operator Theory. 86(1):97-112. https://doi.org/10.1007/s00020-016-2316-zS97112861Albanese A.A., Bonet J., Ricker W.J.: Convergence of arithmetic means of operators in Fréchet spaces. J. Math. Anal. Appl. 401, 160–173 (2013)Albanese, A.A., Bonet, J.,Ricker, W.J.: The Cesàro operator on power series spaces. Preprint (2016)Albrecht E., Miller T.L., Neumann M.M.: Spectral properties of generalized Cesàro operators on Hardy and weighted Bergman spaces. Archiv Math. 85, 446–459 (2005)Aleman A.: A class of integral operators on spaces of analytic functions. In: Proc. of the Winter School in Operator Theory and Complex Analysis, Univ. Málaga Secr. Publ., Málaga, pp. 3–30 (2007)Aleman A., Constantin O.: Spectra of integration operators on weighted Bergman spaces. J. Anal. Math. 109, 199–231 (2009)Aleman A., Persson A.-M.: Resolvent estimates and decomposable extensions of generalized Cesàro operators. J. Funct. Anal. 258, 67–98 (2010)Aleman A., Siskakis A.G.: An integral operator on H p . Complex Var. Theory Appl. 28, 149–158 (1995)Aleman A., Siskakis A.G.: Integration operators on Bergman spaces. Indiana Univ. Math. J. 46, 337–356 (1997)Bayart F., Matheron E.: Dynamics of Linear Operators. Cambridge University Press, Cambridge (2009)Bierstedt K.D., Bonet J., Galbis A.: Weighted spaces of holomorphic functions on balanced domains. Michigan Math. J. 40, 271–297 (1993)Bierstedt K.D., Bonet J., Taskinen J.: Associated weights and spaces of holomorphic functions. Studia Math. 127, 137–168 (1998)Bierstedt, K.D., Summers, W.H.: Biduals of weighted Banach spaces of analytic functions. J. Aust. Math. Soc. 54, 70–79 (1993)Bonet J., Domanski P., Lindström M.: Essential norm and weak compactness on weighted Banach spaces of analytic functions. Can. Math. Bull. 42, 139–148 (1999)Curbera G.P., Ricker W.J.: Extensions of the classical Cesàro operator on Hardy spaces. Math. Scand. 108, 279–290 (2011)Danikas N., Siskakis A.: The Cesàro operator on bounded analytic functions. Analysis 13, 295–299 (1993)Duren P.: Theory of H p Spaces. Academic Press, New York (1970)Dunford N., Schwartz J.T.:Linear Operators I: General Theory, 2nd Printing. Wiley Interscience Publ., New York (1964)Grosse-Erdmann K., Peris A.: Linear Chaos. Springer, London (2011)Harutyunyan A., Lusky W.: On the boundedness of the differentiation operator between weighted spaces of holomorphic functions. Studia Math. 184, 233–247 (2008)Hedenmalm H., Korenblum B., Zhu K.: Theory of Bergman Spaces. Grad. Texts in Math., vol. 199. Springer, New York (2000)Katzelson Y., Tzafriri L.: On power bounded operators. J. Funct. Anal. 68, 313–328 (1968)Krengel U.: Ergodic Theorems. de Gruyter Studies in Mathematics, vol. 6. Walter de Gruyter Co., Berlin (1985)Lin M.: On the uniform ergodic theorem. Proc. Am. Math. Soc. 43, 337–340 (1974)Lusky W.: On the isomorphism classes of weighted spaces of harmonic and holomorphic functions. Studia Math. 175(1), 19–40 (2006)Megginson R.E.: An Introduction to Banach Space Theory. Springer, New York (1998)Meise R., Vogt D.: Introduction to Functional Analysis. Clarendon Press, Oxford (1997)Persson A.-M.: On the spectrum of the Cesàro operator on spaces of analytic functions. J. Math. Anal. Appl. 340, 1180–1203 (2008)Rubel L.A., Shields A.L.: The second dual of certain spaces of analytic functions. J. Aust. Math. Soc. 11, 276–280 (1970)Shields A.L., Williams D.L.: Bounded projections, duality and multipliers in spaces of analytic functions. Trans. Am. Math. Soc. 162, 287–302 (1971)Siskakis A.: Volterra operators on spaces of analytic functions—a survey. In: Proc. of the First Advanced Course in Operator Theory and Complex Analysis, Univ. Sevilla Serc. Publ., Seville, pp. 51–68 (2006

Sorption–desorption of flucarbazone and propoxycarbazone and their benzenesulfonamide and triazolinone metabolites in two soils

5 pages, 3 figures, 1 table, 17 references.Sorption–desorption interactions of pesticides with soil determine the availability of pesticides in soil for transport, plant uptake and microbial degradation. These interactions are affected by the physical and chemical properties of the pesticide and soil and, for some pesticides, their residence time in the soil. While sorption–desorption of many herbicides has been characterised, very little work in this area has been done on herbicide metabolites. The objective of this study was to characterise sorption–desorption of two sulfonylaminocarbonyltriazolinone herbicides, flucarbazone and propoxycarbazone, and their benzenesulfonamide and triazolinone metabolites in two soils with different physical and chemical properties. Kf values for all four chemicals were greater in clay loam soil, which had higher organic carbon and clay contents than loamy sand. Kf−oc ranged from 29 to 119 for the herbicides and from 42 to 84 for the metabolites. Desorption was hysteretic in every case. Lower desorption in themore sorptive system might indicate that hysteresis can be attributed to irreversible binding of the molecules to soil surfaces. These data show the importance of characterisation of both sorption and desorption of herbicide residues in soil, particularly in the case of prediction of herbicide residue transport. In this case, potential transport of sulfonylaminocarbonyltriazolinone herbicidemetabolites would be overpredicted if parent chemical soil sorption values were used to predict transport.Peer reviewe

Differential Brain Activation to Angry Faces by Elite Warfighters: Neural Processing Evidence for Enhanced Threat Detection

10.1371/journal.pone.0010096PLoS ONE54

Herschel Planetary Nebula Survey (HerPlaNS) - First Detection of OH+ in Planetary Nebulae

We report the first detections of OH$^+$ emission in planetary nebulae (PNe). As part of an imaging and spectroscopy survey of 11 PNe in the far-IR using the PACS and SPIRE instruments aboard the Herschel Space Observatory, we performed a line survey in these PNe over the entire spectral range between 51 and 672$\mu$m to look for new detections. OH$^+$ rotational emission lines at 152.99, 290.20, 308.48, and 329.77$\mu$m were detected in the spectra of three planetary nebulae: NGC 6445, NGC 6720, and NGC 6781. Excitation temperatures and column densities derived from these lines are in the range of 27 to 47 K and 2$\times$10$^{10}$ to 4 $\times$10$^{11}$ cm$^{-2}$, respectively. In PNe, the OH+ rotational line emission appears to be produced in the photodissociation region (PDR) in these objects. The emission of OH+ is observed only in PNe with hot central stars (T$_{eff}$ > 100000 K), suggesting that high-energy photons may play a role in the OH+ formation and its line excitation in these objects, as it seems to be the case for ultraluminous galaxies.Comment: 9 pages, 7 figures; accepted for publication in A&

A Statistical Inference Method for Interpreting the CLASP Observations

On 3rd September 2015, the Chromospheric Lyman-Alpha SpectroPolarimeter (CLASP) successfully measured the linear polarization produced by scattering processes in the hydrogen Lyman-$\alpha$ line of the solar disk radiation, revealing conspicuous spatial variations in the $Q/I$ and $U/I$ signals. Via the Hanle effect the line-center $Q/I$ and $U/I$ amplitudes encode information on the magnetic field of the chromosphere-corona transition region (TR), but they are also sensitive to the three-dimensional structure of this corrugated interface region. With the help of a simple line formation model, here we propose a statistical inference method for interpreting the Lyman-$\alpha$ line-center polarization observed by CLASP.Comment: Accepted for publication in The Astrophysical Journa