440 research outputs found
Body Mass Index in Pregnancy Does Not Affect Peroxisome Proliferator‑activated Receptor Gamma Promoter Region (−359 to −260) Methylation in the Neonate
Background: Obesity in pregnancy can contribute to epigenetic changes.Aim: To assess whether body mass index (BMI) in pregnancy is associated with changes in the methylation of the peroxisome proliferator‑activated receptor γ (PPAR) promoter region (−359 to − 260) in maternal and neonatal leukocytes.Subjects and Methods: In this matched, cohort study 41 pregnant women were allocated into two groups: (a) Normal weight (n = 21) and (b) overweight (n = 20). DNA was extracted from maternal and neonatal leukocytes (4000–10,000 cells) in MagNA Pure (Roche) using MagNA Pure LC DNA Isolation Kit 1 (Roche, Germany). Treatment of DNA (2 μg) was performed with sodium bisulfite (EZ DNA Methylation‑Direct™ Kit; Zymo Research). Real‑time quantitative polymerase chain reaction (qPCR) was performed in a LightCycler 2.0 (Roche) using the SYBR® Advantage® qPCR Premix Kit (Clontech). The primers used for PPARg coactivator (PPARG) M3 were 5’‑aagacggtttggtcgatc‑3’ (forward), and5’‑cgaaaaaaaatccgaaatttaa‑3’ (reverse) and those for PPARG unmethylated were: 5’‑gggaagatggtttggttgatt‑3’ (forward) and 5’‑ttccaaaaaaaaatccaaaatttaa‑3’ (reverse). Intergroup differences were calculated using the Mann–Whitney U‑test, and intragroup differences, with the Wilcoxon test (IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp.).Results: Significant differences were found in BMI, pregestational weight, and postdelivery weight between groups but not in the methylation status of the PPARγ promoter region (−359 to − 260).Conclusion: The PPARγ promoter region (−359 to − 260) in peripheral leukocytes is unlikely to get an obesity‑induced methylation in pregnancy.Keywords: Body mass index, Methylation, Peroxisome proliferator‑activated receptor gamma, Pregnanc
Sociedade do Conhecimento, Empoderamento e Produção de Consensos na Saúde
Graças à tecnologia, entre outros fatores, o conhecimento pode tornarse uma das principais causas de superação de desigualdades e de propagação do bemestar. O advento da sociedade da informação é o fundamento de novas formas de organização e de produção em escala mundial. Estamos vivendo um novo tempo, com novas tecnologias e novos atores sociais que vestem novas roupagens e utilizam novos espaços de interação
Attributable mortality of vancomycin resistance in ampicillin-resistant Enterococcus faecium bacteremia in Denmark and the Netherlands: A matched cohort study
OBJECTIVE: To study whether replacement of nosocomial ampicillin-resistant Enterococcus faecium (ARE) clones by vancomycin-resistant E. faecium (VRE), belonging to the same genetic lineages, increases mortality in patients with E. faecium bacteremia, and to evaluate whether any such increase is mediated by a delay in appropriate antibiotic therapy. DESIGN: Retrospective, matched-cohort study. SETTING: The study included 20 Dutch and Danish hospitals from 2009 to 2014. PATIENTS: Within the study period, 63 patients with VRE bacteremia (36 Dutch and 27 Danish) were identified and subsequently matched to 234 patients with ARE bacteremia (130 Dutch and 104 Danish) for hospital, ward, length of hospital stay prior to bacteremia, and age. For all patients, 30-day mortality after bacteremia onset was assessed. METHODS: The risk ratio (RR) reflecting the impact of vancomycin resistance on 30-day mortality was estimated using Cox regression with further analytic control for confounding factors. RESULTS: The 30-day mortality rates were 27% and 38% for ARE in the Netherlands and Denmark, respectively, and the 30-day mortality rates were 33% and 48% for VRE in these respective countries. The adjusted RR for 30-day mortality for VRE was 1.54 (95% confidence interval, 1.06-2.25). Although appropriate antibiotic therapy was initiated later for VRE than for ARE bacteremia, further analysis did not reveal mediation of the increased mortality risk. CONCLUSIONS: Compared to ARE bacteremia, VRE bacteremia was associated with higher 30-day mortality. One explanation for this association would be increased virulence of VRE, although both phenotypes belong to the same well-characterized core genomic lineage. Alternatively, it may be the result of unmeasured confounding
Structure and evolution of the magnetochrome domains: no longer alone
Magnetotactic bacteria (MTB) can swim along Earth's magnetic field lines, thanks to the alignment of dedicated cytoplasmic organelles. These organelles, termed magnetosomes, are proteolipidic vesicles filled by a 35–120 nm crystal of either magnetite or greigite. The formation and alignment of magnetosomes are mediated by a group of specific genes, the mam genes, encoding the magnetosome-associated proteins. The whole process of magnetosome biogenesis can be divided into four sequential steps; (i) cytoplasmic membrane invagination, (ii) magnetosomes alignment, (iii) iron crystal nucleation and (iv) species-dependent mineral size and shape control. Since both magnetite and greigite are a mix of iron (III) and iron (II), iron redox state management within the magnetosome vesicle is a key issue. Recently, studies have started pointing out the importance of a MTB-specific c-type cytochrome domain found in several magnetosome-associated proteins (MamE, P, T, and X). This magnetochrome (MCR) domain is almost always found in tandem, and this tandem is either found alone (MamT), in combination with a PDZ domain (MamP), a domain of unknown function (MamX) or with a trypsin combined to one or two PDZ domains (MamE). By taking advantage of new genomic data available on MTB and a recent structural study of MamP, which helped define the MCR domain boundaries, we attempt to retrace the evolutionary history within and between the different MCR-containing proteins. We propose that the observed tandem repeat of MCR is the result of a convergent evolution and attempt to explain why this domain is rarely found alone
Роль географического фактора в формировании британского менталитета (на материале английской фразеологии)
Цель исследования – определить роль влияния географического положения страны на
формирование менталитета носителей языка и их национальный характер
Narrar la propia biografía después de un divorcio : notas de un estudio cualitativo de interés para la demografía
En este artículo se discuten algunos resultados de un estudio cualitativo sobre las trayectorias familiares que siguen hombres y mujeres que han vivido una ruptura de una unión en la que hubo hijos. Primero se presenta el diseño de la metodología cualitativa y luego se ofrecen algunos resultados del trabajo de campo realizado en áreas metropolitanas de España donde el divorcio tiene una intensidad mayor. Las narraciones de nuestros biógrafos y biógrafas permiten discutir a fondo el significado mutante de la familia y los vínculos afectivos en la llamada moderna sociedad líquida, y revisar de forma crítica tres conceptos básicos del análisis demográfico de las biografías de rupturas de unión: familia, la datación de los acontecimientos y los llamados factores determinantes.In this article some outcomes of a qualitative study on the familiar trajectories that follow men and women who have experienced a break-up of union in which there were children are discussed. The design of the qualitative methodology is first presented before showing some results of the fieldwork done in metropolitan areas of Spain where the divorce has a greater intensity. The narrations of our biographers allow us to discuss the meaning of the family and the affective ties in the so-called liquid modern society and to review three basic concepts of the demographic analysis of the biographies of union ruptures: family, timing of the events and the determinant factors.Dans cet article on discute quelques résultats d'une étude qualitative sur les trajectoires familiales qu'ils suivent des hommes et des femmes qui ont vécu une rupture d'une union dans laquelle il y a eu des enfants. On présente d'abord la conception de la méthodologie qualitative et on offre ensuite quelques résultats de la recherche effectué dans des secteurs métropolitains de l'Espagne où le divorce a une intensité plus grande. Les narrations de nos biographes permettent d'examiner en profondeur la signification mutant de la famille et les liens affectifs dans la moderne société liquide, et de réviser de manière critique trois concepts de base de l'analyse démographique des biographies de ruptures d'union: famille, datation des événements et facteurs déterminants
Allometry of root branching and its relationship to root morphological and functional traits in three range grasses
The study of proportional relationships between size, shape, and function of part of or the whole organism is traditionally known as allometry. Examination of correlative changes in the size of interbranch distances (IBDs) at different root orders may help to identify root branching rules. Root morphological and functional characteristics in three range grasses {bluebunch wheatgrass [Pseudoroegneria spicata (Pursh) Löve], crested wheatgrass [Agropyron desertorum (Fisch. ex Link) Schult.×A. cristatum (L.) Gaert.], and cheatgrass (Bromus tectorum L.)} were examined in response to a soil nutrient gradient. Interbranch distances along the main root axis and the first-order laterals as well as other morphological and allocation root traits were determined. A model of nutrient diffusivity parameterized with root length and root diameter for the three grasses was used to estimate root functional properties (exploitation efficiency and exploitation potential). The results showed a significant negative allometric relationship between the main root axis and first-order lateral IBD (P ≤0.05), but only for bluebunch wheatgrass. The main root axis IBD was positively related to the number and length of roots, estimated exploitation efficiency of second-order roots, and specific root length, and was negatively related to estimated exploitation potential of first-order roots. Conversely, crested wheatgrass and cheatgrass, which rely mainly on root proliferation responses, exhibited fewer allometric relationships. Thus, the results suggested that species such as bluebunch wheatgrass, which display slow root growth and architectural root plasticity rather than opportunistic root proliferation and rapid growth, exhibit correlative allometry between the main axis IBD and morphological, allocation, and functional traits of roots
The number of metastable states in the generalized random orthogonal model
We calculate the number of metastable states in the generalized random
orthogonal model. The results obtained are verified by exact numerical
enumeration for small systems sizes but taking into account finite size
effects. These results are compared with those for Hopfield model in order to
examine the effect of strict orthonormality of neural network patterns on the
number of metastable states.Comment: 12 pages, 4 EPS figure
Cosmic Statistics of Statistics
The errors on statistics measured in finite galaxy catalogs are exhaustively
investigated. The theory of errors on factorial moments by Szapudi & Colombi
(1996) is applied to cumulants via a series expansion method. All results are
subsequently extended to the weakly non-linear regime. Together with previous
investigations this yields an analytic theory of the errors for moments and
connected moments of counts in cells from highly nonlinear to weakly nonlinear
scales. The final analytic formulae representing the full theory are explicit
but somewhat complicated. Therefore as a companion to this paper we supply a
FORTRAN program capable of calculating the described quantities numerically
(abridged).Comment: 18 pages, 9 figures, Latex (MN format), published in MNRAS 310, 428
with slight correction
- …