Mechanisms for restraining and deploying a 50-kW solar array

Design and hardware of restraining and deploying mechanism for solar array of Mars flyby missio

Qué nivel de conceptualización legitima el docente en clases de química de primer año de polimodal. una mirada desde el discurso

El trabajo analiza la influencia del diálogo áulico, en la conceptualización del contenido Reacción Química, mediante investigación etnográfica con estudio interpretativo y de casos, en clases de primer año de nivel polimodal (16 a17 años) de dos docentes de esuelas Argentinas. Se analiza el contenido curricular expresado en niveles de conceptualización, lo cual se explicita en los mensajes que planifica y legitima el docente en las clases

A methodology for the construction of efficient PLC based low-power photovoltaic generation plants

The research of the operation of low-power photovoltaic generation plants used for self-contained electric power supply in Siberian climatic conditions is performed in this paper. It provides an analysis of the operation of individual units of an automated control system, and gives recommendations for the selection of hardware components. The article describes the operational principles, developed based on functional modules of the programmable logic controller, ensuring maximum possible use of solar energy in this continuous power supply system. The results of plant operation have been obtained, in the form of a power counter log, as well as data on the volume of solar energy produced in both overcast and in sunny weather, throughout the observation period. The article provides visual illustration of generated energy, which could be used to assess the efficiency and economic viability of the low-power photovoltaic plant. Authors would like to point out that examples of the proposed methodology for the construction of self-contained power supply systems can be found in existing industrial facilities, on which further scientific research can be based

Improving the reliability of busbar protection system with IEC 61850 GOOSE based communication

The main task of the “relay” protection system is to provide trip commands in case of faults and to prevent the operation of the electrical equipment in dangerous modes. The set of the protection functions and the system structure have an impact on the reliability and respectively dependability of the protected structure. In some smaller node-point electrical facilities like step-up substations for PVPPs and wind-farms, the set of protection functions required by the respective regulations can be limited. The multifunctional features of new generations of Intelligent Electronic Devices (IEDs) and the options to use IEC 61850 based communication, protection and automation, provide opportunities for improvement of the busbar protection system

CHARACTERISTICS OF SELF-ORGANIZATION ACADEMIC ACTIVITY OF STUDENTS OF THE COLLEGE

В статье рассматривается проблема изучения роли психологических характеристик в самоорганизации учебной деятельности студентов колледжа. Автор определяет теоретико-методологические аспекты, эффективные формы и методы изучения самоорганизации учебной деятельности студентов колледжаThe problem of the level of development self-organization of College students. The author describes the theoretical and methodological aspects of effective forms and methods of studying the self-organization of educational activity of students of the Colleg

Extirpation of distal part of the pacreas in the severe erosive intraperitoneal bleeding caused by postoperative necrotic acute pancreatitis

Institutul de chirurgie „A.V. Vishnevskii”, Moscova, Rusia, Al XII-lea Congres al Asociației Chirurgilor „Nicolae Anestiadi” din Republica Moldova cu participare internațională 23-25 septembrie 2015Introducere: Pancreatita acută postoperatorie (PAP) reprezintă o complicație gravă ce apare după o intervenție chirurgicală pe pancreas (P). Incidența ei poate atinge 58,9%, în timp ce formele severe se întîlnesc în 24,2% cazuri (Kubyshkin V.A.). O trăsătură distinctivă este apariția pe fonul acesteia a dehiscenței anastomotice, fistulelor pancreatice (FP) și hemoragiilor erozive (HE). Scopul lucrării: De a aprecia eficacitatea rezecției bontului pancreatic în caz de HE postoperatorie. Material și metode: La 17 pacienți sursa de HE a fost vena lienală și mezenterică superioară, artera hepatică și mezenterică superioară. Toți pacienții au fost distribuiți în 2 grupuri. În primul grup (5 pacienți) intervenția chirurgicală s-a finisat cu suturarea și ligaturarea vaselor, în cel de-al doilea – extirparea bontului pancreatic. HE a apărut în 8-15 zile după operația inițială, în timp ce FP a fost obsevată în toate cazurile. Rezultate: Toți pacienții au suportat intervenție chirurgicală de urgență. Suturarea vasului sîngerînd s-a efectuat în 5 cazuri, dintre care în 3 au fost relevate hemoragii repetate (toți 5 pacienți au decedat). Extirparea bontului distal pancreatic a fost efectuată la 12 pacienți, dintre care 8 au supraviețuit, iar 4 au decedat. În toate cazurile de deces operația a fost efectuată în condiții de anemie posthemoragică severă. Concluzii: Suturarea și ligaturarea vasului sîngerînd în cazul PAP necrotice deseori este neefectivă și se soldează cu decesul pacientului. Profilaxia apariției și tratamentul adecvat al PAP permite prevenirea formării FP și reduce riscul apariției HE. Extirparea bontului distal pancreatic în cazul PAP severe, deși este o intervenție de disperare, poate fi recomandată cu scop curativ.Introduction: Postoperative acute pancreatitis (PAP) is a serious complication that occurs after surgery on the pancreas (P). The incidence can reach 58.9%, while severe forms are encountered in 24.2% cases (Kubyshkin VA). Its distinctive feature is the occurence of anastomotic dehiscence, pancreatic fistulas (PF) and erosive hemorrhage (EH). The aim: To assess the effectiveness of distal pancreatic resection in cases of postoperative EH. Material and methods: In 17 patients the source of EH was superior mesenteric and splenic vein, hepatic and superior mesenteric artery. All patients were divided into 2 groups. In the first group (5 patients) surgery ended with suturing and ligation of vessels in the second group – distal pancreatic resection was performed. EH appeared in 8-15 days after the initial surgery. PF was mentioned in all cases. Results: All patients have undergone emergency surgery. The suture of the bleeding vessel was performed in 5 cases, including 3 cases of repeated bleeding (all 5 patients died). Distal pancreatic resection was performed in 12 patients: 8 pat ients have survived, 4 – died. In all cases of death, the surgery was performed in patients with posthaemorrhagic severe anemia. Conclusions: Suturing and ligation of bleeding vessels in necrotic PAP is inefficient and often leads to death of the patient. The prevention of occurrence and adequate treatment of PAP allows to prevent the PF formation and reduces the risk of EH. Extirpation of distal part of the pancreas cause a severe PAP, though is an desperate operation, but may be recommended for therapeutic purposes

ИССЛЕДОВАНИЕ И РАЗРАБОТКА МЕТОДА КОНТРОЛЯ ПАТОГЕННЫХ ПРИОННЫХ ИНФЕКЦИЙ ПОБОЧНОГО СЫРЬЯ МЯСНОЙ ПРОМЫШЛЕННОСТИ

Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries) revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail). The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left) and CAGTTTCGATCCTCCTCCAG (right) primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.Разработан высокочувствительный и специфичный метод идентификации патогенного прионного белка. Установлено, что фракции водорастворимых белков говядины и плазмы крови сельскохозяйственных животных являются нормальными прионными белками крупного рогатого скота. Выравнивание последовательностей гена  патогенного и нормального прионного белка Ovisaries, показало, что нуклеотидные последовательности PrPc и PrPsc являются идентичными. Выбрано мышиное моноклональное антитело 15В3. Построена синтетическая последовательность, дли-ной 194 п.н., полученная случайным образом (ДНК-хвост). Созданная последовательность и последовательности базы данных гомологов не имеют. К синтезированному ДНК-хвосту подобраны 2 праймера размерами 20 п.н. Полученныеэкспериментальные данные указывают на то, что при использовании праймеров AGTCAGTCCTTGGCCTCCTT (левого) и CAGTTTCGATCCTCCTCCAG (правого)  амплификацию следует проводить по следующей схеме: предварительная денатурация, 95 °С, 60 секунд, 1 цикл; денатурация, 95 °С, 30 секунд, 30 циклов; отжиг, 56 °С, 60 секунд, 30 циклов; элонгация, 72 °С, 30 секунд, 30 циклов,  дополнительная элонгация в течение 1 цикла продолжительностью 600 секунд.Установлена оптимальная концентрация компонентов реакционной смеси для проведения ПЦР. Подтверждена высокая специфичность разработанной тест-системы и олигонуклеотидных праймеров путем электрофоретического разделения образцов мясного фарша, содержащего патогенный прионный белок, а также путем  сравнительного анализа результатов определения патогенного прионного белка,полученных с помощью ПЦР-тест-системы и ИФА-системы «TeSeE™»

ROLE OF CYTOKINE-MEDIATED MECHANISMS IN DEVELOPMENT OF POST-TRAUMATIC MANDIBULAR OSTEOMYELITIS

Osteomyelitis of the lower jaw is one of the urgent problems of modern medicine. There are many reasons for the evolvement of purulent necrotic processes of the jaw bones, including the role of disorders in the systems of innate and adaptive immunity. The aim of the study was to determine the content of TNFα, IL-17, IL-4 in serum and mixed saliva in patients with uncomplicated mandibular fractures and posttraumatic osteomyelitis to determine the possibility of using these indicators for early diagnosis of posttraumatic complications. The article presents the results of a study of tumor necrosis factor α (TNFα), interleukin-17 (IL-17) and interleukin-4 (IL-4) cytokines in serum and mixed saliva in patients with uncomplicated mandibular fracture and post-traumatic osteomyelitis at the first and tenth days of observation. By means of single-layer neural networks, binary classifiers were built, allowing patients to be stratified by the clinical form of the disease and to predict its course. The probability of uncomplicated mandibular fracture is described by the ratio P = 1/(1+e-z), where the index z is determined by the level of TNFα, IL-17, and IL-4 at the first and tenth day of observation. The simulation confirmed high prognostic significance of serum TNFα and IL-17 for early verification of posttraumatic osteomyelitis, which was confirmed by the OTC and ROC indices, which varied from 87 to 100% in different models. Models 4 and 5, where TNFα recorded on the tenth day of the study was used as predictors, and a combination of TNFα and IL-17 obtained on the first day of hospitalization, were the most accurate. Modeling the results of the study of immunological indicators in the mixed saliva showed that the predictive properties have only IL-4 and IL-17, was on the tenth day of hospitalization that distinguishes these binary classifiers from similar indexes, derive from the levels of cytokines in blood serum. The results of the study indicate the important role of disorders in the system of рro- and anti-inflammatory cytokines in pathogenesis of post-traumatic osteomyelitis

Examining the Evidence for Chytridiomycosis in Threatened Amphibian Species

Extinction risks are increasing for amphibians due to rising threats and minimal conservation efforts. Nearly one quarter of all threatened/extinct amphibians in the IUCN Red List is purportedly at risk from the disease chytridiomycosis. However, a closer look at the data reveals that Batrachochytrium dendrobatidis (the causal agent) has been identified and confirmed to cause clinical disease in only 14% of these species. Primary literature surveys confirm these findings; ruling out major discrepancies between Red List assessments and real-time science. Despite widespread interest in chytridiomycosis, little progress has been made between assessment years to acquire evidence for the role of chytridiomycosis in species-specific amphibian declines. Instead, assessment teams invoke the precautionary principle when listing chytridiomycosis as a threat. Precaution is valuable when dealing with the world's most threatened taxa, however scientific research is needed to distinguish between real and predicted threats in order to better prioritize conservation efforts. Fast paced, cost effective, in situ research to confirm or rule out chytridiomycosis in species currently hypothesized to be threatened by the disease would be a step in the right direction. Ultimately, determining the manner in which amphibian conservation resources are utilized is a conversation for the greater conservation community that we hope to stimulate here

Two-Stage Treatment of Enterocutaneous Fistulas

Aim: to determine the most efficient treatment of enterocutaneous fistulas.Materials and methods. Eighty-eight patients with intestinal fistulas underwent a two-stage treatment, including: the first stage — multicomponent therapy, the second stage — reconstructive surgery. Enterocutaneous fistulas were diagnosed in 61 patients, enteroatmospheric fistulas — in 26 patients, and combined fistula (enterocutaneous and enteroatmospheric) — in 1 patient.Results. All 88 patients underwent reconstructive surgery after the multicomponent therapy. Resection of the intestine with a fistula with the formation of an entero-entero anastomosis was performed in 72 (81.8 %) patients; marginal resection of the intestine with a fistula, followed by suturing of the defect — in 7 (8.0 %); resection of the intestine with fistulas in combination with excision and suturing of the fistula — in 5 (5.7 %); an operation aimed at disabling the fistula from the passage of intestinal contents — in 3 (3.4 %); resection of the intestine with a fistula in combination with fistula exclusion — in 1 (1.1 %) patient. Postoperative complications in the group of patients with enteroatmospheric fistulas occurred in 13 cases, in the group with enterocutaneous fistulas — in 25 patients. Three (3.4 %) patients with enterocutaneous fistulas died from complications unrelated to the underlying disease and surgical interventions.Conclusion. Two-stage treatment including multicomponent therapy (nutritional support, infection generalization control, local wound treatment) and reconstructive surgery allowed to reduce mortality rates to 3.4 %, which proves the effectiveness of this method