Multiplex ligation-dependent probe amplification for genetic screening in autism spectrum disorders: Efficient identification of known microduplications and identification of a novel microduplication in ASMT

<p>Abstract</p> <p>Background</p> <p>It has previously been shown that specific microdeletions and microduplications, many of which also associated with cognitive impairment (CI), can present with autism spectrum disorders (ASDs). Multiplex ligation-dependent probe amplification (MLPA) represents an efficient method to screen for such recurrent microdeletions and microduplications.</p> <p>Methods</p> <p>In the current study, a total of 279 unrelated subjects ascertained for ASDs were screened for genomic disorders associated with CI using MLPA. Fluorescence in situ hybridization (FISH), quantitative polymerase chain reaction (Q-PCR) and/or direct DNA sequencing were used to validate potential microdeletions and microduplications. Methylation-sensitive MLPA was used to characterize individuals with duplications in the Prader-Willi/Angelman (PWA) region.</p> <p>Results</p> <p>MLPA showed two subjects with typical ASD-associated interstitial duplications of the 15q11-q13 PWA region of maternal origin. Two additional subjects showed smaller, <it>de novo </it>duplications of the PWA region that had not been previously characterized. Genes in these two novel duplications include <it>GABRB3 </it>and <it>ATP10A </it>in one case, and <it>MKRN3</it>, <it>MAGEL2 </it>and <it>NDN </it>in the other. In addition, two subjects showed duplications of the 22q11/DiGeorge syndrome region. One individual was found to carry a 12 kb deletion in one copy of the <it>ASPA </it>gene on 17p13, which when mutated in both alleles leads to Canavan disease. Two subjects showed partial duplication of the <it>TM4SF2 </it>gene on Xp11.4, previously implicated in X-linked non-specific mental retardation, but in our subsequent analyses such variants were also found in controls. A partial duplication in the <it>ASMT </it>gene, located in the pseudoautosomal region 1 (PAR1) of the sex chromosomes and previously suggested to be involved in ASD susceptibility, was observed in 6–7% of the cases but in only 2% of controls (P = 0.003).</p> <p>Conclusion</p> <p>MLPA proves to be an efficient method to screen for chromosomal abnormalities. We identified duplications in 15q11-q13 and in 22q11, including new <it>de novo </it>small duplications, as likely contributing to ASD in the current sample by increasing liability and/or exacerbating symptoms. Our data indicate that duplications in <it>TM4SF2</it> are not associated with the phenotype given their presence in controls. The results in PAR1/PAR2 are the first large-scale studies of gene dosage in these regions, and the findings at the <it>ASMT </it>locus indicate that further studies of the duplication of the <it>ASMT </it>gene are needed in order to gain insight into its potential involvement in ASD. Our studies also identify some limitations of MLPA, where single base changes in probe binding sequences alter results. In summary, our studies indicate that MLPA, with a focus on accepted medical genetic conditions, may be an inexpensive method for detection of microdeletions and microduplications in ASD patients for purposes of genetic counselling if MLPA-identified deletions are validated by additional methods.</p

A genistein derivative, ITB-301, induces microtubule depolymerization and mitotic arrest in multidrug-resistant ovarian cancer

PURPOSE: To investigate the mechanistic basis of the anti-tumor effect of the compound ITB-301. METHODS: Chemical modifications of genistein have been introduced to improve its solubility and efficacy. The anti-tumor effects were tested in ovarian cancer cells using proliferation assays, cell cycle analysis, immunofluorescence, and microscopy. RESULTS: In this work, we show that a unique glycoside of genistein, ITB-301, inhibits the proliferation of SKOv3 ovarian cancer cells. We found that the 50% growth inhibitory concentration of ITB-301 in SKOv3 cells was 0.5 μM. Similar results were obtained in breast cancer, ovarian cancer, and acute myelogenous leukemia cell lines. ITB-301 induced significant time- and dose-dependent microtubule depolymerization. This depolymerization resulted in mitotic arrest and inhibited proliferation in all ovarian cancer cell lines examined including SKOv3, ES2, HeyA8, and HeyA8-MDR cells. The cytotoxic effect of ITB-301 was dependent on its induction of mitotic arrest as siRNA-mediated depletion of BUBR1 significantly reduced the cytotoxic effects of ITB-301, even at a concentration of 10 μM. Importantly, efflux-mediated drug resistance did not alter the cytotoxic effect of ITB-301 in two independent cancer cell models of drug resistance. CONCLUSION: These results identify ITB-301 as a novel anti-tubulin agent that could be used in cancers that are multidrug resistant. We propose a structural model for the binding of ITB-301 to α- and β-tubulin dimers on the basis of molecular docking simulations. This model provides a rationale for future work aimed at designing of more potent analogs

Mutation analysis of the NSD1 gene in patients with autism spectrum disorders and macrocephaly

<p>Abstract</p> <p>Background</p> <p>Sotos syndrome is an overgrowth syndrome characterized by macrocephaly, advanced bone age, characteristic facial features, and learning disabilities, caused by mutations or deletions of the <it>NSD1 </it>gene, located at 5q35. Sotos syndrome has been described in a number of patients with autism spectrum disorders, suggesting that <it>NSD1 </it>could be involved in other cases of autism and macrocephaly.</p> <p>Methods</p> <p>We screened the <it>NSD1 </it>gene for mutations and deletions in 88 patients with autism spectrum disorders and macrocephaly (head circumference 2 standard deviations or more above the mean). Mutation analysis was performed by direct sequencing of all exons and flanking regions. Dosage analysis of <it>NSD1 </it>was carried out using multiplex ligation-dependent probe amplification.</p> <p>Results</p> <p>We identified three missense variants (R604L, S822C and E1499G) in one patient each, but none is within a functional domain. In addition, segregation analysis showed that all variants were inherited from healthy parents and in two cases were also present in unaffected siblings, indicating that they are probably nonpathogenic. No partial or whole gene deletions/duplications were observed.</p> <p>Conclusion</p> <p>Our findings suggest that Sotos syndrome is a rare cause of autism spectrum disorders and that screening for <it>NSD1 </it>mutations and deletions in patients with autism and macrocephaly is not warranted in the absence of other features of Sotos syndrome.</p

Tuning microtubule dynamics to enhance cancer therapy by modulating FER-mediated CRMP2 phosphorylation

Though used widely in cancer therapy, paclitaxel only elicits a response in a fraction of patients. A strong determinant of paclitaxel tumor response is the state of microtubule dynamic instability. However, whether the manipulation of this physiological process can be controlled to enhance paclitaxel response has not been tested. Here, we show a previously unrecognized role of the microtubule-associated protein CRMP2 in inducing microtubule bundling through its carboxy terminus. This activity is significantly decreased when the FER tyrosine kinase phosphorylates CRMP2 at Y479 and Y499. The crystal structures of wild-type CRMP2 and CRMP2-Y479E reveal how mimicking phosphorylation prevents tetramerization of CRMP2. Depletion of FER or reducing its catalytic activity using sub-therapeutic doses of inhibitors increases paclitaxel-induced microtubule stability and cytotoxicity in ovarian cancer cells and in vivo. This work provides a rationale for inhibiting FER-mediated CRMP2 phosphorylation to enhance paclitaxel on-target activity for cancer therapy

Ribosome profiling reveals a functional role for autophagy in protein translational control

Autophagy promotes protein degradation, and therefore has been proposed to maintain amino acid pools to sustain protein synthesis during metabolic stress. To date, how the autophagy pathway influences the protein translational landscape in mammalian cells remains unclear. Here, we utilize ribosome profiling to delineate the effects of genetic ablation of the autophagy regulator, ATG12, on protein translational control. In mammalian cells, genetic loss of autophagy does not impact global rates of cap dependent translation, even under starvation conditions. Instead, autophagy supports the translation of a subset of mRNAs with complex 5'UTR structures, enriched for cell cycle control and DNA damage repair. In particular, we demonstrate that autophagy enables the translation of the DNA damage repair protein BRCA2, which is functionally required to attenuate DNA damage and promote cell survival in response to PARP inhibition. Overall, our findings illuminate a new role for autophagy directing the protein translational landscape.Raw data: fastq files are named according to biological replicate, total RNA or RNA protected fragment, and condition. RPKK1-4 indicates which biological replicate the sequencing is from, Total indicates all RNA from the sample, RPF means ribosome protected fragment from the sample, 1-4 indicates condition where 1 = Atg12f/f in control media, 2 = Atg12f/f in starvation (HBSS2h), 3 = Atg12KO in control media, 4 = Atg12KO in starvation (HBSS2h). The adapter sequence is adapter: AGATCGGAAGAGCACACGTCT Babel: For Babel analysis, the raw files are grouped by replicate and condition, and compared to each other by condition. Files were read into babel as follows: - :sample_name: control_fed_1 :rna: :inputs: - RPKK1Total1_S43_L006_R1_001.fastq.gz - RPKK1Total1_S59_L006_R1_001.fastq.gz :rp: :inputs: - RPKK1RPF1_S39_L006_R1_001.fastq.gz - RPKK1RPF1_S55_L006_R1_001.fastq.gz - :sample_name: control_fed_2 :rna: :inputs: - RPKK2Total1_S31_L005_R1_001.fastq.gz - RPKK2Total1_S37_L005_R1_001.fastq.gz :rp: :inputs: - RPKK2RPF1_S27_L005_R1_001.fastq.gz - RPKK2RPF1_S33_L005_R1_001.fastq.gz - :sample_name: control_fed_3 :rna: :inputs: - RPKK3Total1_S23_L004_R1_001.fastq.gz :rp: :inputs: - RPKK3RPF1_S19_L004_R1_001.fastq.gz - :sample_name: control_fed_4 :rna: :inputs: - RPKK4Total1_S35_L005_R1_001.fastq.gz - RPKK4Total1_S41_L005_R1_001.fastq.gz :rp: :inputs: - RPKK4RPF1_S47_L006_R1_001.fastq.gz - RPKK4RPF1_S63_L006_R1_001.fastq.gz #2 - :sample_name: control_starved_1 :rna: :inputs: - RPKK1Total2_S44_L006_R1_001.fastq.gz - RPKK1Total2_S60_L006_R1_001.fastq.gz :rp: :inputs: - RPKK1RPF2_S40_L006_R1_001.fastq.gz - RPKK1RPF2_S56_L006_R1_001.fastq.gz - :sample_name: control_starved_2 :rna: :inputs: - RPKK2Total2_S32_L005_R1_001.fastq.gz - RPKK2Total2_S38_L005_R1_001.fastq.gz :rp: :inputs: - RPKK2RPF2_S28_L005_R1_001.fastq.gz - RPKK2RPF2_S34_L005_R1_001.fastq.gz - :sample_name: control_starved_3 :rna: :inputs: - RPKK3Total2_S24_L004_R1_001.fastq.gz :rp: :inputs: - RPKK3RPF2_S20_L004_R1_001.fastq.gz - :sample_name: control_starved_4 :rna: :inputs: - RPKK4Total2_S36_L005_R1_001.fastq.gz - RPKK4Total2_S42_L005_R1_001.fastq.gz :rp: :inputs: - RPKK4RPF2_S48_L006_R1_001.fastq.gz - RPKK4RPF2_S64_L006_R1_001.fastq.gz #3 - :sample_name: atg_minus_fed_1 :rna: :inputs: - RPKK1Total3_S45_L006_R1_001.fastq.gz - RPKK1Total3_S61_L006_R1_001.fastq.gz :rp: :inputs: - JG01/RPKK1RPF3_S41_L006_R1_001.fastq.gz - JG01/RPKK1RPF3_S57_L006_R1_001.fastq.gz - :sample_name: atg_minus_fed_2 :rna: :inputs: - RPKK2Total3_S33_L005_R1_001.fastq.gz - RPKK2Total3_S39_L005_R1_001.fastq.gz :rp: :inputs: - RPKK2RPF3_S29_L005_R1_001.fastq.gz - RPKK2RPF3_S35_L005_R1_001.fastq.gz - :sample_name: atg_minus_fed_3 :rna: :inputs: - RPKK3Total3_S25_L004_R1_001.fastq.gz :rp: :inputs: - RPKK3RPF3_S21_L004_R1_001.fastq.gz - :sample_name: atg_minus_fed_4 :rna: :inputs: - RPKK4Total3_S37_L005_R1_001.fastq.gz - RPKK4Total3_S43_L005_R1_001.fastq.gz :rp: :inputs: - RPKK4RPF3_S49_L006_R1_001.fastq.gz - RPKK4RPF3_S65_L006_R1_001.fastq.gz #4 - :sample_name: atg_minus_starved_1 :rna: :inputs: - RPKK1Total4_S46_L006_R1_001.fastq.gz - RPKK1Total4_S62_L006_R1_001.fastq.gz :rp: :inputs: - RPKK1RPF4_S42_L006_R1_001.fastq.gz - RPKK1RPF4_S58_L006_R1_001.fastq.gz - :sample_name: atg_minus_starved_2 :rna: :inputs: - RPKK2Total4_S34_L005_R1_001.fastq.gz - RPKK2Total4_S40_L005_R1_001.fastq.gz :rp: :inputs: - RPKK2RPF4_S30_L005_R1_001.fastq.gz - RPKK2RPF4_S36_L005_R1_001.fastq.gz - :sample_name: atg_minus_starved_3 :rna: :inputs: - RPKK3Total4_S26_L004_R1_001.fastq.gz :rp: :inputs: - RPKK3RPF4_S22_L004_R1_001.fastq.gz - :sample_name: atg_minus_starved_4 :rna: :inputs: - RPKK4Total4_S38_L005_R1_001.fastq.gz - RPKK4Total4_S44_L005_R1_001.fastq.gz :rp: :inputs: - RPKK4RPF4_S50_L006_R1_001.fastq.gz - RPKK4RPF4_S66_L006_R1_001.fastq.gz :babel_tests: - :babel_name: all_groups :groups: - :group_name: control_fed :samples: [ control_fed_1, control_fed_2, control_fed_3, control_fed_4 ] - :group_name: control_starved :samples: [ control_starved_1, control_starved_2, control_starved_3, control_starved_4 ] - :group_name: atg_minus_fed :samples: [ atg_minus_fed_1, atg_minus_fed_2, atg_minus_fed_3, atg_minus_fed_4 ] - :group_name: atg_minus_starved :samples: [ atg_minus_starved_1, atg_minus_starved_2, atg_minus_starved_3, atg_minus_starved_4 ] autophagy_rp_orf.cov: shows number of read counts per mRNA identifier. columns are for each sample. control = Atg12f/f; atg_minus = Atg12KO number indicates which biological replicate .rna = total RNA ; .rp = RPF autophagy_rp_qcsummary: provides quality control information for the sequencing and data analysis. Columns present data per sample. control = Atg12f/f; atg_minus = Atg12KO number indicates which biological replicate .rna = total RNA ; .rp = RPF Reading the Babel outputs in R: see autophagy_rp_analysis.R. All statistical results comparing ribosome occupancy between conditions from Babel (between.babel analysis) are also presented as .csv files. Column names: mRNA_logFC indicates mRNA fold change on log scale between conditions; mRNA_pval indicates significance of the mRNA change between conditions; pval indicates significance of ribosome occupancy change between conditions; FDR indicates false discovery rate of ribosome occupancy change between conditions; Direction indicates whether the ribosome occupancy was enriched or decreased between conditions. For Atg12ff_Fed_v_Atg12KO_Fed.csv and Atg12ff_starved_v_AtgKO_starved.csv: -1 = ribosome occupancy higher in Atg12KO; 1 = ribosome occupancy higher in Atg12f/f. For Atg12ff_Fed_v_Atg12ff_starved.csv: -1 = ribosome occupancy higher in starved than fed; 1 = ribosome occupancy higher in fed than starved Funding provided by: National Institutes of HealthCrossref Funder Registry ID: http://dx.doi.org/10.13039/100000002Award Number: R01AG057462Funding provided by: National Institutes of HealthCrossref Funder Registry ID: http://dx.doi.org/10.13039/100000002Award Number: R01CA213775Funding provided by: National Institutes of HealthCrossref Funder Registry ID: http://dx.doi.org/10.13039/100000002Award Number: R01CA126792Funding provided by: National Institutes of HealthCrossref Funder Registry ID: http://dx.doi.org/10.13039/100000002Award Number: P30CA082103Funding provided by: DOD BCRPCrossref Funder Registry ID: Award Number: W81XWH-11-1-0130Funding provided by: National Science FoundationCrossref Funder Registry ID: http://dx.doi.org/10.13039/100000001Award Number: DGE -1144247Funding provided by: National Institutes of HealthCrossref Funder Registry ID: http://dx.doi.org/10.13039/100000002Award Number: NCI 1F31CA217015Funding provided by: QB3/Calico Longevity FellowshipCrossref Funder Registry ID: Award Number: Funding provided by: Samuel Waxman Cancer Research FoundationCrossref Funder Registry ID: http://dx.doi.org/10.13039/100001384Award Number:Immortalized mouse embryonic fibroblasts of the genotype Atg12f/f;CagCreER+ were grown in DMEM supplemented with 10% serum. 5 days prior to the experiment, half of the cells were treated with 2uM 4-hydoxytamoxifen for three consecutive days to induce deletion of Atg12. Ribosome profiling experiments were performed using the ARTseq Ribosome profiling kit (Epicentre). Briefly, immortalized Atg12f/f or Atg12KO MEFs were maintained in control media (DMEM + 10% fetal bovine serum) or starved in HBSS for 2 hours. Following the starvation period, cycloheximide made fresh to 50mg/ml in Ethanol for each experiment was added at a final concentration of 100ug/ml. Then, cells were collected in PBS and preparation of the samples was performed according the ARTseq Ribosome profiling kit manufacturer's instructions. RNA extraction by Trizol LS (Ambion), rRNA depletion via RiboZero Gold (Epicentre), and quality and quantity of small RNA and DNA assayed using Agilent High Sensitivity Small RNA kit and DNA kit respectively (Agilent). Sequencing was performed at the UCSF sequencing core on Illumina HiSeq2000 as single reads at 150nt length, and analysis of reads was performed using Babel (Olshen et al, 2013) with alignment to mm10.protein_coding.ensembl_76. Subsequent analysis of the processed data was performed in R

PRELIMINARY INVESTIGATIONS INTO THE TAXONOMY OF THE GALL MIDGES (DIPTERA: CECIDOMYIIDAE) AFFECTING CAPSICUM SP IN JAMAICA

Persistent interception of a Dipteran larva in shipments of hot pepper (Capsicum chinense) from Jamaica to the United States of America (USA) in recent years, has led to the imposition of mandatory fumigation of the commodity prior to export. The insect has been identified both as Contarinia lycopersici, a tomato pest of quarantine importance to the USA and Prodiplosis longifilia a citrus pest restricted in that country to Florida. The present study compares the pepper midges in Jamaica with C. lycopersici and P. longifilia based on morphological characteristics and host infestation. Preliminary results derived from comparative morphological examination of adult males, suggest that the pepper gall midges of Jamaica are distinguishable from C. lycopersici and P. longifilia. There is an urgent need to identify and or describe the species present in order to develop a management strategy for the pest

Translation regulation by autophagy and nutrient stress

Protein translation is necessary for cell function, but it is an incredibly energy demanding process, and is therefore tightly regulated by the metabolic state of the cell. There are a plethora of translation control mechanisms that are only recently being elucidated. My thesis research has investigated how perturbing the metabolic state of the cell, both subtly via autophagy inhibition and with a sledge-hammer of acute amino acid starvation, impacts translation rates on both a global and mRNA by mRNA basis. Overall, I found that these stresses do not repress translation as expected, indicating the identification of novel mechanisms of protein translation regulation.The majority of my thesis focused on the role of autophagy in regulating protein translation. Autophagy, a cellular sorting, degradation and recycling system, is crucial for the survival of cells under stress and has been demonstrated to play a role in the progression of many human diseases, including cancer and neurodegeneration. By promoting protein degradation, autophagy is proposed to maintain amino acid pools to sustain protein synthesis during metabolic stress. I utilized ribosome profiling to delineate the effects of acute genetic ablation of autophagy on protein translational control. Instead of shaping overall global rates of cap dependent translation, autophagy supports the translation of specific mRNAs, most notably targets involved in cell cycle control and DNA damage repair, by modulating the availability of RNA binding proteins to interact with mRNAs. Specifically, by enabling the protein translation of the DNA damage repair protein BRCA2, autophagy is functionally required to attenuate DNA damage as well as promote cell survival in response to PARP inhibition. This helps to explain the reported increased DNA damage in autophagy deficient cells, and is an important consideration for autophagy inhibitors as adjuvant chemotherapies, which are being tested now. I have also uncovered a novel mechanism of protein translation regulation following acute amino acid starvation. Although mTORC1 signaling indicates repressed translation, 35S-methionine incorporation rates more than double following amino acid withdrawal. This increase in translation rates can be prevented by addition of leucine, although the molecular mechanisms controlling this novel process remain to be identified