Improved ASTM G72 Test Method for Ensuring Adequate Fuel-to-Oxidizer Ratios

The ASTM G72/G72M-15 Standard Test Method for Autogenous Ignition Temperature of Liquids and Solids in a High-Pressure Oxygen-Enriched Environment is currently used to evaluate materials for the ignition susceptibility driven by exposure to external heat in an enriched oxygen environment. Testing performed on highly volatile liquids such as cleaning solvents has proven problematic due to inconsistent test results (non-ignitions). Non-ignition results can be misinterpreted as favorable oxygen compatibility, although they are more likely associated with inadequate fuel-to-oxidizer ratios. Forced evaporation during purging and inadequate sample size were identified as two potential causes for inadequate available sample material during testing. In an effort to maintain adequate fuel-to-oxidizer ratios within the reaction vessel during test, several parameters were considered, including sample size, pretest sample chilling, pretest purging, and test pressure. Tests on a variety of solvents exhibiting a range of volatilities are presented in this paper. A proposed improvement to the standard test protocol as a result of this evaluation is also presented. Execution of the final proposed improved test protocol outlines an incremental step method of determining optimal conditions using increased sample sizes while considering test system safety limits. The proposed improved test method increases confidence in results obtained by utilizing the ASTM G72 autogenous ignition temperature test method and can aid in the oxygen compatibility assessment of highly volatile liquids and other conditions that may lead to false non-ignition results

Evaluation of Containment Boxes as a Fire Mitigation Method in Elevated Oxygen Conditions

No abstract availabl

Sistema de control interno y gestión administrativa en la institución educativa "Nuestros Héroes de la Guerra del Pacífico", Tacna 2021

El sistema de control interno y la gestión administrativa en la I. E. "Nuestros Héroes de la Guerra del Pacífico" de Tacna, al año 2021, son estudiados en la presenta investigación debido a la problemática que trae la administración en dicha institución. De esta manera, se tuvo por propósito determinar de qué manera se relaciona el sistema de control interno y la gestión administrativa. Para ello, se consideró una totalidad de 63 trabajadores como muestra de estudio, a los cuales se les aplicó la encuesta. Los resultados encontrados fueron que, el 60% de los encuestados indicaron que el sistema de control interno es de nivel medio y el 70% indicaron que la gestión administrativa es de nivel medio. Por lo tanto, con un nivel de confianza del 95% se obtuvo un R de Pearson de 0.970 el cual es significativo al presentar un Valor-p de 0.000 menor que el nivel de significancia, lo que condujo a afirma que el sistema de control interno se relaciona significativamente con la gestión administrativa en la institución educativa “Nuestros Héroes de la Guerra del Pacífico”, Tacna 2021.The internal control system and administrative management in the I.E. "Our Heroes of the Pacific War" of Tacna, to the year 2021, are studied in the present investigation due to the problems that the administration brings in said institution. In this way, the purpose was to determine how the internal control system and administrative management are related. For this, a total of 63 workers was considered as a study sample, to whom the survey was applied. The results found were that 60% of the respondents indicated that the internal control system is of a medium level and 70% indicated that the administrative management is of a medium level. Therefore, with a confidence level of 95%, a Pearson R of 0.970 was obtained, which is significant by presenting a p-value of 0.000 lower than the significance level, which led to affirm that the internal control system is significantly related to the Administrative Management of the Educational Institution "Our Heroes of the Pacific War" of Tacna, 2021

Oxygen Partial Pressure and Oxygen Concentration Flammability: Can They Be Correlated?

No abstract availabl

Determinaciòn espectrofotométrica de metami trona en lixiviados de suelo mediante regresión por mínimos cuadrados parciales

Se desarrolló un método sencillo y selectivo para la determinación espectrofotométrica del herbicida metamitrona en presencia de materia orgánica e hierro, cuyas interferencias fueron eliminadas mediante la Regresión por Mínimos Cuadrados Parciales Tipo I. El modelo de calibración se construyó a partir de una serie de 21 muestras, con concentraciones que oscilaron en el intervalo de 0 a 15 g mL-1 de metamitrona, de 0 a 400 g mL-1 de la sal sódica de ácidos húmicos y de 0 a 50 g mL-1 de sulfato férrico. Para una serie de 15 muestras de validación se estimó un porcentaje de recuperación de 95 ± 6 %, con un error estándar de predicción de 0.6, utilizando un intervalo espectral de 251 a 350 nm, datos centrados sobre la media y dos factores, para la construcción del modelo de calibración.Finalmente, se obtuvo un porcentaje de recuperación de 90 ± 11 % en el análisis de lixiviados acuosos fortificados con metamitrona, provenientes de un suelo franco arcilloso, con un contenido de carbono orgánico del 17 %.

Serum Homocysteine Levels and its Methylenetetrahydrofolate Gene (MTHFR) C677t Polymorphism in Patients with Hemodialysis

Homocysteine plays an important role in cardiovascular disease as an independent risk factor, especially in patients with renal insufficiency. The present study aimed to determine whether Hcy levels, or those of its C677T polymorphism, were associated with higher mortality in patients submitted to chronic hemodialysis treatment. This was a descriptive, prospective study. Chronic renal patients undergoing hemodialysis in the "General Hospital, ISSSTE" Dr. Darío Fernández Fierro, Mexico City were included in the study. Serum homocysteine was analyzed by means of an ELISA test. The primers utilized for MTHFR C677T polymorphism identification were the following: F: 5'TGAAGGAGAAGGTGTCTGCGGGA3', R: 5'AGGACGGTGCGGTGAGTG3' and F2: 5’GCAGGGAGCTTTGAGGCTGAC3’. Differences among nominal conditions were evaluated by the Mann-Whitney U-test. Spearman test was used for correlation among variables. Regression, log-linear analysis and receiver operating characteristic (ROC) curves were conducted to evaluate the possible influence on prognosis of Hcy levels and the presence of the MTHFR C677T polymorphism. Cox regression and Kaplan-Meier tests were performed to evaluate the Hcy levels influence on survival. In all cases, p<0.05 was considered statistically significant. All tests were performed with the SPSS ver. 23 statistical software program. By means of regression analysis (p = 0.046) and ROC curve age was the sole significant prognostic variable for the "death". The loglinear analysis did not show any association between the presence of MTHFR C677T SNP with the mortality of patients. It was concluded that Hcy levels and the presence/absence of MTHFR C677T are not stronger predictors for mortality than the traditional cardiovascular risk factors."Dr. Darío Fernández Fierro" General Hospital. Ciprés Grupo Médico S.C. (CGM)

1068-P: Diabetes and Comorbidities Risk Assessment in Hospitalization and Fatalities from the Mexican COVID-19 Surveillance System

The SARS-CoV-2 outbreak poses a challenge to the Mexican health care system due to its high complication and lethality rates in patients with diabetes and comorbidities. Here, we evaluate the association among diabetes and main comorbidities [obesity, hypertension and chronic kidney disease (CKD)] on COVID-19 outcomes (prevalence, hospitalization, lethality and hospital fatality) in Mexican population. We used available public data released by the Mexican COVID-19 surveillance system (MC-19SS) from January 1st to December 31st of 2020. All 3,401,172 records of SARS-CoV-2 suspected population over or equal to 20 years old were included, out of whom 1,384,470 tested positive. Multiple logistic regression models were fitted to assess the risk over several outcomes (hospitalization and fatality), with self-reported diabetes and comorbidities in confirmed cases, adjusting for age, sex, smoking status and marginalization of the place of residence. Overall population tested, 399,953 (11.8%) subjects had diabetes. Of them, 47.8% also had hypertension, 9.0% obesity and 7.0% CKD. Patients who tested positive to COVID-19 had a higher proportion of diabetes (14.7%). From the 203,310 COVID-19 positive patients with diabetes, 95,225(46.8%) were hospitalized and of those 45,128(47.4%) died; also 4,701 died without had been hospitalized. People with diabetes had significant (p&amp;lt;.005) higher odds of hospitalization OR:2.2, hospital 1.27 and non-hospital 1.98 fatality. Nevertheless, subjects with diabetes and other chronic disease experience higher rates of several outcomes. Diabetes and CKD had the highest odds of hospitalization 7.3 died in hospital (2.14) or out of hospital (6.5) compared with cases without diabetes. This analysis points out that diabetes contributes to the risk of infection and worse outcomes for those infected by SARS-CoV-2. More must be done to combat and prevent diabetes and comorbidities to reduce the burden of COVID-19. Disclosure H. Gallardo-rincón: None. A. Montoya: None. L. Martinez-juarez: Research Support; Self; Lilly Global Health Partnership. J. Lomelin-gascon: None. E. R. Saucedo-martinez: None. R. Mujica-rosales: None. R. Tapia-conyer: None

A fluorogenic probe for granzyme B enables in-biopsy evaluation and screening of response to anticancer immunotherapies

Immunotherapy promotes the attack of cancer cells by the immune system; however, it is difficult to detect early responses before changes in tumor size occur. Here, we report the rational design of a fluorogenic peptide able to detect picomolar concentrations of active granzyme B as a biomarker of immune-mediated anticancer action. Through a series of chemical iterations and molecular dynamics simulations, we synthesize a library of FRET peptides and identify probe H5 with an optimal fit into granzyme B. We demonstrate that probe H5 enables the real-time detection of T cell-mediated anticancer activity in mouse tumors and in tumors from lung cancer patients. Furthermore, we show image-based phenotypic screens, which reveal that the AKT kinase inhibitor AZD5363 shows immune-mediated anticancer activity. The reactivity of probe H5 may enable the monitoring of early responses to anticancer treatments using tissue biopsies

Ciudad-territorio sustentable. Procesos, actores y estructuras

En los últimos años, los estudios urbanos especializados insisten en que los procesos de urbanización por los que atraviesan los distintos países desarrollados, parecen dejar atrás las explicaciones de la urbanización industrial, han surgido otras construcciones y perspectivas unas más acabadas que otras (Indovina, 1998, la “ciudad difusa”; Dematteis 1998, ciudad sin centros; Nel-lo, 1998 ciudad sin confines, Soja, 2008, la exópolis). En suma se dice que se avanza hacia la urbanización generalizada, ello acaba con la larga trayectoria del funcionamiento y naturaleza de la ciudad moderna, el cambio urbano estructural actual, es nuevamente, consecuencia de la descentralización, difusión, redistribución del desarrollo, del crecimiento y las innovaciones ahora sobre una estructura en el territorio. Ha sido una mutación no sólo empírica sino que ha dado lugar a la confrontación teórica. El sistema urbano jerárquico ha reducido su valor interpretativo porque se han modificado los supuestos en los que se basaban las relaciones de dominio y dependencia de los centros principales, porque se han abaratado los costos de transporte y el efecto de la distancia ya no es una limitante absoluta, ahora los procesos productivos flexibles y descentralizados propician las relaciones técnicas horizontales con lo cual se consiguen economías de escala externas e internas a las empresas en un territorio ampliado y no sólo exclusivamente en la aglomeración económica (Precedo, 2003; Veltz, 1999; Boix, 2002; Camagni, 2005; De Santiago, 2008 y; Garmendia, 2010).El objetivo es examinar dentro de la descentralización del proceso urbano a la ciudad-territorio en América Latina, en particular en México. En contextos urbanos desarrollados se afirma la convergencia urbana con la apertura de las unidades funcionales de los sistemas urbanos donde operan redes e interrelaciones de desarrollo cualitativo en el territorio. América Latina registra evidencias empíricas poco claras, existe alta concentración de aquella economía que contribuye al crecimiento nacional, mientras la población se descentraliza rápidamente. México, es un caso de primacía urbana histórica aunque da paso a la formación de regiones urbanas, mismas que reproducen relaciones polarizadas y escasamente descentralizadas. De manera que, en tanto domine la concentración espacial económica, la ciudadterritorio se podrá presentar en el continente sólo con algunos rasgos en regiones urbanas con mayor desarrollo y crecimiento. Palabras claves: descentralización urbana, sistema urbano, ciudad-territorio

Obesity is associated with insulin resistance and components of the metabolic syndrome in Lebanese adolescents

adolescents has been reported to range between 18–42%, depending on country of origin, thus suggesting an ethnicbased association between obesity and MS. Aim: This study aims to investigate the magnitude of the association between obesity, insulin resistance and components of MS among adolescents in Lebanon. Subjects and methods: The sample included 263 adolescents at 4 th and 5 th Tanner stages of puberty (104 obese; 78 overweight; 81 normal weight). Anthropometric, biochemical and blood pressure measurements were performed. Body fat was assessed using dual-energy X-ray absorptiometry. Results: According to International Diabetes Federation criteria, MS was identified in 21.2 % of obese, 3.8 % of overweight and 1.2 % of normal weight subjects. The most common metabolic abnormalities among subjects having MS were elevated waist circumference (96.2%), low HDL (96.2%) and hypertriglyceridemia (73.1%). Insulin resistance was identified in all subjects having MS. Regression analyses showed that percentage body fat, waist circumference and BMI were similar in their ability to predict the MS in this age group. Conclusions: MSwas identified in asubstantial proportion of Lebanese obese adolescents, thus highlighting the importance of early screening for obesity-associated metabolic abnormalities and of developing successful multi-component interventions addressing adolescent obesity