Penilaian Risiko Kualitatif Masuknya Rabies Melalui Pergerakan Anjing dari Provinsi Jawa Barat ke Kota Surakarta

Abstrak      Lalu lintas anjing dari daerah tertular rabies ke daerah bebas rabies masih terjadi di Indonesia. Hal ini menjadi salah satu pemicu terhadap munculnya kasus rabies di daerah bebas. Penelitian ini bertujuan untuk melakukan penilaian risiko kualitatif kemungkinan masuknya rabies melalui pergerakan anjing konsumsi dari Jawa Barat ke Kota Surakarta, Provinsi Jawa Tengah. Metode pengumpulan data yang digunakan dalam penelitian ini menggunakan data primer dan data sekunder. Data primer diperoleh dari wawancara, kuesioner, pendapat pakar, dan observasi langsung di lapangan. Data sekunder diperoleh melalui kajian literatur, penelusuran publikasi ilmiah, dan dokumen dari instansi berwenang yang tidak dipublikasikan. Hasil penelitian menunjukkan bahwa penilaian pelepasan dari daerah asal anjing adalah “sedang” dengan ketidakpastian rendah. Tingkat kejadian rabies pada hewan di Provinsi Jawa Barat tahun 2019 sebesar 3,1%. Penilaian pendedahan adalah “tinggi” dengan ketidakpastian rendah karena frekuensi pengiriman anjing konsumsi dari Jawa Barat dilakukan setiap hari. Penilaian dampak adalah “tinggi” dengan ketidakpastian rendah karena ada dampak tunggal yang masuk dalam kategori signifikan di tingkat nasional. Hasil penelitian dapat disimpulkan bahwa penilaian risiko kualitatif masuknya rabies ke Kota Surakarta adalah tinggi dengan ketidakpastian rendah. Evaluasi kemungkinan kualitatif dapat mempertimbangkan tingkat kejadian rabies daerah asal dan frekuensi pengiriman anjing konsumsi setiap hari yang merupakan masalah penting risiko masuknya rabies.

Molecular Detection of Hemagglutinin Gene Fragment of Avian Influenza Virus H9 Subtype Obtained from Poultry Commercial Farm with Prominent Symptom of Decreased Egg Production

Avian influenza virus H9N2 subtype is considered a low pathogenic strain that has been reported in Indonesia since late 2016. The outbreak has caused economic losses for farmers due to the sharp drop in egg production. The evidence of the existence of AIV H9N2 has been published, but very limited information on the prominent symptom and macroscopic lesion. This research was a retrospective study of suspected avian influenza H9 subtype, obtained from layer commercial farm with recorded characteristic symptoms. Specific trachea samples were collected and further processed to be isolated, propagated using embryonated chicken egg, and then extracted the RNA for molecular detection using real-time reverse transcriptase-polymerase chain reaction (RT-qPCR). A positive result was further detected in its H-9 gene with  RT-PCR technique and sequencing methods. One of five samples showed positive for RT-qPCR with CT value 30.19. Sequence analysis confirmed that the sample with characteristic macroscopic lesion could be detected in the presence of the AIV H9 subtype. Phylogenetic tree analyses revealed that this virus belongs to the China-Vietnam- Indonesia (CVI) lineage

PF-3 Prevalence and Risk Factors of Jembrana Disease, Bengkalis District Riau Province

Jembrana disease (JD) is contagious viral disesase in Bali cattle, caused by Retrovirus from member of Lentivirus group called by Jembrana disease virus (JDV). Jembrana disease outbreak in Bengkalis district first occured 2013 and until now is endemic. This purpose of study is to determine the prevalence of JD and to identify a risk factor associated with JD in Bengkalis district

Pengaruh Nitrogen dan Silika terhadap Pertumbuhan dan Perkembangan Spodoptera litura (Lepidoptera: Noctuidae) pada Kedelai

A study was conducted to establish the indirect effects of nitrogen (N) and silicon (Si) on the growth and development of Spodoptera litura on soybean. A full-factorial experiment was arranged in 4x2 factors: first factor was nitrogen with varied doses of 0, 25, 50, and 100 kg/ha; second factor was silicon at 0 and 200 g/m2. The results demonstrated that the application of N and Si indirectly affected the growth and development of S. litura including leaves consumed, weight of larvae, weight of pupal, fecundity and survivorship. In addition, combination of nitrogen and silicon also affected the growth and development of soybean as evidenced by the decreased absorption of Si by soybean following the application of N, while the application of Si combined with high nitrogen doses decreased the absorption of Si. It was also observed that the effect of N was not significant on the growth and development of S. litura.  The application of Si with the high N doses, however, decreased the growth and development of S. litura. It is, therefore, concluded that the mechanism of relationship between N and Si on S. litura could not be explained only by quantifying the absorption value of N and Si

PRAKTIK BIOSEKURITI DAN SANITASI PETERNAK BABI TERKAIT PENGENDALIAN HOG CHOLERA DI KECAMATAN KOTA RAJA KOTA KUPANG

Pigs have a very important value for the people in NTT. Apart from being farm animals that have economic value, pigs also have an important role in the socio-cultural and religious life in NTT. Given its important role for the community, pigs need serious attention to avoid various disease threats, one of which is Hog cholera (HC). One of the effective ways to prevent HC disease that can be done is by implementing strict biosecurity and sanitation. The purpose of this research is to learn how the practice of biosecurity and sanitation by pig farmers is one of the most important efforts in preventing the spread of HC disease in the Kota Raja Sub-District, Kupang City. The data in this study were obtained through direct interviews with pig farmers in the Kota Raja Sub-District, Kupang City, and analyzed with descriptive statistics. The results showed that the level of HC vaccination was still low at 10.9%, and there were still many farmers who carried out risky practices for HC transmission such as consuming or trading pigs that died from sickness 29.1%, throwing away pig carcasses that died from sickness 5%, back yard slaughtering 40%, disposing of slaughtering waste into the environment 9.1%. In conclusion, the practice of biosecurity and sanitation carried out by pig farmers in the Kota Raja Sub-District, Kupang City still needs to be improved. There are still some pig farmers who practice practices that are risky for disease transmission in pigs, especially Hog cholera

Risk Factor Identification and Incidence Rate Measurement on One High-Risk Farm as Brucellosis Precautions in Metro City Lampung

Since 2011, Lampung is one of the Brucella-free areas, but April 2021 reported abortion case in a cow farm     at Metro city Lampung Province. The purpose of this study was to identify risk factors and measure incidence levels as vigilance re-emerging Brucellosis. Sample of cow serum, taken in a census from whole cattle cow in a farm at risk, as much as 2 times with a distance about 1 month. In the first census, 703 serum samples were taken from the stables and 25 samples from the adjacent. Whole sample tested to Brucella spp with rose bengal test (RBT) and positive result confirmed with complement fixation test (CFT). The second census was conducted on samples without positive CFT results in the first census. The positive RBT at second sensus were followed by CFT and c-Elisa tests. Incidence rate of brucellosis in high-risk housing in Banjarsari Village, North Metro District, Metro City 1,67% or 2 brucellosis per 100 cows a month. Brucella spp. seropositivity was significantly related to the type of species and sex of the animal; animals with Ongole breed 4.2 times and female animals 4.5 times have a higher level of exposure compared to non-Ongole breed animals and males

PATH ANALYSIS TINGKAT PENGETAHUAN, SIKAP DAN PRAKTIK PETERNAK BABI TERHADAP PENGENDALIAN HOG CHOLERA DI KECAMATAN KOTA RAJA KOTA KUPANG

Pig population in East Nusa Tenggara Province in 2019 was recorded at around 2 million pigs. In east Nusa Tenggara around 85% of the households raise at least 1 (one) pig per household. Pig farming industry has its own challenges and resistances, one of the challenge is the threat of infectious diseases such as Hog cholera disease. Hog cholera is a disease caused by virus and has become endemic in most of the area in East Nusa Tenggara with relatively high prevalence. In Kupang City the prevalence of HC in 2018 was recorded at around 20,5%. The aim of this study is to analyse the relationship of pig farmer characteristics with knowledge level, attitude and practice regarding HC controlling and eradication in Kota Raja Sub-distric Kupang City. In this study, data was obtained by questionnaire and interview of pig farmers which was done in Kota Raja Sub-distric from August until October 2018. Data was analyzed with descriptive statistic and KAP studi data was analyzed with path analysis to measure the relationship between observed characteristics and HC controlling practice. The result of this study shows that variable that has the stongest relationship to practice is level of education with path coefficient (r) of -0,438 (P 0,027), followed by attitude with path coefficient (r) of 0,233 (P 0,000), and then followed by knowledge with path coefficient (r) of 0,224 (P 0,008) and the weakest realationship to practice is farmers age with path coefficient (r) of -0,049 (P 0,016)

Molecular Study on The Pathogenicity of Avian Influenza Virus

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny

Tingkat Kekebalan Anjing Terhadap Rabies di Kota Ambon = Herd Immunity Against Rabies Among Dogs in Ambon

The objectives of this study were to reveals factors associated with level of herd immunity against rabies. Four hundred and eighteen blood samples were collected from five subdistricts and 14 villages using stratified and household cluster methods. The result in ELISA test is &#88050,5 IV/ml, dog titers sample was stated as protective to rabies. The result showed that the prevalence of protective antibody titers was very low i.e. 3.35%. Linear regression analysis reveals subdistrict of Nusaniwe, subdistrict of Baguala, dog owner education, postvaccination period of 0 - 6 months, sex, and dogs kept as a guard house contribute to protective level of antibody titers. Unweighted logistic regression revealed that subdistrict of Baguala (OR = 0.05), subdistrict of Sirimau OR = 0.09), dog kept as a guard house (OR = 3.96), dog owner education (OR = 12.29), and post-vaccination period of 0 - 6 months (OR = 27.08) are significantly associated with dog\u27s immunity. Vaccination programs need be improved by considering the four factors that emerged in these two regression results. Penelitian ini bertujuan untuk mengungkap tingkat kekebalan anjing terhadap rabies di Kota Ambon. Sebanyak 418 sampel darah anjing yang berasal dari lima kecamatan dan 14 desalkelurahan dengan metode tahapan berganda dan klaster. Hasil pengujian ELISA &#88050,5 IU/ml, maka titer dinyatakan protektif terhadap rabies. Hasil penelitian menunjukkan prevalensi titer antibodi protektif sangat rendah yaitu 3,35%. Analisis linear regressionmenunjukkan Kecamatan Nusaniwe, Kecamatan Baguala, pendidikan pemilik anjing, periode pascavaksinasi 0 - 6 bulan, jenis kelamin, dan anjing yang dipelihara sebagai penjaga rumah secara signifikan memengaruhi titer antibodi protektif. Analisis unweighted logistic regression menunjukkan faktor yang berasosiasi dengan tingkat kekebalan anjing yaitu Kecamatari-Baguala (OR=0,05), Kecamatan Sirimau (OR=0,09), anjing yang dipelihara sebagai penjaga rumah (OR=3,96), pendidikan pemilik anjing (OR=12,29), dan periode pascavaksinasi 0 - 6 bulan (OR=27,08). Program vaksinasi perlu ditingkatkan dengan memperhatikan empat faktor yang muncul pada kedua hasilregresi