Temporal summation in a neuromimetic micropillar laser

Neuromimetic systems are systems mimicking the functionalities orarchitecture of biological neurons and may present an alternativepath for efficient computing and information processing. We demonstratehere experimentally temporal summation in a neuromimetic micropillarlaser with integrated saturable absorber. Temporal summation is theproperty of neurons to integrate delayed input stimuli and to respondby an all-or-none kind of response if the inputs arrive in a sufficientlysmall time window. Our system alone may act as a fast optical coincidence detector and paves the way to fast photonic spike processing networks

Spatiotemporal chaos induces extreme events in an extended microcavity laser

Extreme events such as rogue wave in optics and fluids are often associated with the merging dynamics of coherent structures. We present experimental and numerical results on the physics of extreme events appearance in a spatially extended semiconductor microcavity laser with intracavity saturable absorber. This system can display deterministic irregular dynamics only thanks to spatial coupling through diffraction of light. We have identified parameter regions where extreme events are encountered and established the origin of this dynamics in the emergence of deterministic spatiotemporal chaos, through the correspondence between the proportion of extreme events and the dimension of the strange attractor

Dynamics and rheology of highly deflated vesicles

We study the dynamics and rheology of a single two-dimensional vesicle embedded in a linear shear flow by means of numerical simulations based on the boundary integral method. The viscosities inside and outside the vesicle are supposed to be identical. We explore the rheology by varying the reduced area, i.e. we consider more and more deflated vesicles. Effective viscosity and normal stress differences are computed and discussed in detail, together with the inclination angle and the lateral membrane velocity (tank-treading velocity). The angle is found, surprisingly, to reach a zero value (flow alignment) at a critical reduced area even in the absence of viscosity contrast. A Fast Multipole Method is presented that enables to run efficiently simulations with a large number of vesicles. This method prevails over the direct summation for a number of mesh points beyond a value of about 103. This offers an interesting perspective for simulation of semi-dilute and concentrated suspensions

"Inspire and conspire": Italian precarious workers between self-organization and self-advocacy

The scenario we see today in the labor market in Italy is composed of a progressive proliferation of non-standard contracts. This involves first and foremost a problem of citizenship and welfare, due to the lower or almost nonexistent possibility of access to social rights associated with these types of contracts. Faced with this situation, over the last ten years, Italy has seen the emergence of a complex social movement to counter precariousness. This movement at first concentrated its efforts in the rewriting of the symbolic vocabulary and imagination at work, in an attempt to consolidate the precarious as a collective subjectivity beyond its traditional representations. In recent years, however, this process of “self-representation” in terms of a collective narrative is matched by a process of “self-advocacy”: an effective self-organization of temporary workers to handle the conflict in the workplace. In a scenario of no confidence in political parties and trade unions in addressing the issue of precariousness, these movements refuse the delegation of the conflict, promoting instead a modality of action based on the organizational form of the network, sharing knowledge and direct representation. This paper explores two particular movement experiences in the Italian context

“Inspire and conspire”: Italian precarious workers between self-organization and self-advocacy

The scenario we see today in the labor market in Italy is composed of a progressive proliferation of non-standard contracts. This involves first and foremost a problem of citizenship and welfare, due to the lower or almost nonexistent possibility of access to social rights associated with these types of contracts. Faced with this situation, over the last ten years, Italy has seen the emergence of a complex social movement to counter precariousness. This movement at first concentrated its efforts in the rewriting of the symbolic vocabulary and imagination at work, in an attempt to consolidate the precarious as a collective subjectivity beyond its traditional representations. In recent years, however, this process of \u201cself-representation\u201d in terms of a collective narrative is matched by a process of \u201cself-advocacy\u201d: an effective self-organization of temporary workers to handle the conflict in the workplace. In a scenario of no confidence in political parties and trade unions in addressing the issue of precariousness, these movements refuse the delegation of the conflict, promoting instead a modality of action based on the organizational form of the network, sharing knowledge and direct representation. This paper explores two particular movement experiences in the Italian context

First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia

Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia. Samples of wild grapevines were labeled during the vegetative season and dormant canes from 84 accessions (male and female plants) were collected during winter. All samples were tested by RT-PCR for the presence of GRSPaV using primers RSP-48 (5'- AGCTGGGATTATAAGGGAGGT-3') and RSP-49 (5'- CCAGCCGTTCCACCACTAAT-3') (Lima et al. 2006a) for the amplification of a 331 bp fragment of the coat protein (CP) gene. Results showed that 51% (43/84) of the samples were infected by GRSPaV. In order to confirm the presence of this virus in wild grapevines, two positive samples (VS56 and VS70) were tested by RT-PCR using primers RSP-52 (5'-TGAAGGCTTTAGGGGTTAG-3') and RSP-53 (5'-CTTAACCCAGCCTTGAAAT-3') (Rowhani et al. 2000) to amplify the complete CP. Isolate VS56 was from a male plant in northern Tunisia and isolate VS70 was from a female plant in the northeast of the country. PCR products of these two isolates were cloned and sequenced in both directions. The Tunisian GRSPaV isolates VS56 (LT855232) and VS70 (LT855235) shared 84% nucleotide sequence identity. Isolate VS56 had 85-86% identity with all GRSPaV sequences available in GenBank, whereas VS70 showed 93-99% identities with isolates SK704-A (KX274274) and ORPN12 (FJ943318). To further confirm the presence of GRSPaV in wild grapevines, the same two samples were tested by RT-PCR using primers McK1U (AGGGATTGGCTGTTAGATGTT) and McK1D (CTTCAGGCAACCCCAAAAA) (Nolasco et al. 2000) to amplify a 355 bp fragment of the RNA-dependent RNA polymerase domain. Isolates VS56 (LT906626) and VS70 (LT906636) shared 89% nucleotide sequence identity. Isolate VS56 had 89-94% identity with isolates SK30 (KX274277) and GRSPaV-MG (FR691076) while VS70 showed 94-95% identity with isolates Tannat-Rspav1 (KR528585) and GRSPaV-GG (JQ922417). To our knowledge, this is the first report of GRSPaV in wild grapevines in Tunisia

Efeitos do carprofeno no ganho de força tênsil muscular e cutânea em ratas (Rattus norvegicus) submetidas à Laparorrafia mediana

O artigo não apresenta resumo

Emprego de n-butil-cianoacrilato associado ou não à sutura na síntese de gastrotomias em ratos (Rattus norvegicus)

O artigo não apresenta resumo

Special nuclear material detection studies with the SMANDRA mobile system

The detection of special nuclear material has been studied with the SMANDRA mobile inspection system used both as a high sensitivity passive neutron/gamma spectroscopic tool and as an active inspection device using tagged neutrons. The detection of plutonium samples is possible with passive interrogation, the passive detection of uranium being much more difficult because of the low neutron yield and of the easiness of shielding the gamma rays. However, we show that active interrogation with tagged neutrons is able to provide signatures for the discrimination of uranium against other materials