Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer

Formation and Use of Staff Potential of National Economy Формирование и использование кадрового потенциала национальной экономики

The article presents the author’s version of a definition of the essence of the “staff potential of national economy” notion and improved structural and logical model of formation and use of staff potential of a macro level with an expanded range of factors of external environment.В статье представлена авторская версия определения сущности понятия «кадровый потенциал национальной экономики» и усовершенствованная структурно-логическая модель формирования и использования кадрового потенциала макроуровня с расширенной совокупностью факторов внешней среды

Study of School Child Motor Activity Using Individual Wearable Devices - Fitness-trackers

They presented the results of qualitative and quantitative indicator study concerning the motor activity of schoolchildren of both sexes, obtained by using individual wearable devices-fitness trackers. It was found that 8.2% of students, regardless of gender and age, are characterized by low values ​​of this indicator; 3.4% demonstrate high values ​​of the indicator relative to the hygiene norm

Annelated tricyclic thiophenes and their photophysical properties

International audiencePhotochemical oxidative cyclization of 3-[(E)-2-(3,4-di-methoxyphenyl)vinyl]thiophene and its 15-crown-5-analogue (15-[(E)-2-(3-thienyl)vinyl]-2,3,5,6,8,9,11,12-octahydro-1,4,7,10,13-benzopentaoxacyclopentadecine) affords the isomeric thiophene-containing fused aromatic compounds demonstrating photophysical properties different from those of initial styryl derivatives. E-Configuration of the initial styryl dye, 3-[(E)-2-(3,4-dimethoxyphenyl)vinyl]thiophene, has been proved by X-ray analysis

New Cytogenetic Photomap and Molecular Diagnostics for the Cryptic Species of the Malaria Mosquitoes Anopheles messeae and Anopheles daciae from Eurasia

The Eurasian malaria vector Anopheles messeae is a widely spread and genetically diverse species. Five widespread polymorphic chromosomal inversions were found in natural populations of this mosquito. A cryptic species, Anopheles daciae, was differentiated from An. messeae by the presence of several nucleotide substitutions in the Internal Transcribed Spacer 2 (ITS2) region of ribosomal DNA. However, because of the absence of a high-quality reference cytogenetic map, the inversion polymorphisms in An. daciae and An. messeae remain poorly understood. Moreover, a recently determined heterogeneity in ITS2 in An. daciae questioned the accuracy of the previously used Restriction Fragment Length Polymorphism (RFLP) assay for species diagnostics. In this study, a standard-universal cytogenetic map was constructed based on orcein stained images of chromosomes from salivary glands for population studies of the chromosomal inversions that can be used for both An. messeae and An. daciae. In addition, a new ITS2-RFLP approach for species diagnostics was developed. Both methods were applied to characterize inversion polymorphism in populations of An. messeae and An. daciae from a single location in Western Siberia in Russia. The analysis demonstrates that cryptic species are remarkably different in their frequencies of chromosomal inversion variants. Our study supports previous observations that An. messeae has higher inversion polymorphism in all autosomes than the cryptic species An. daciae

Antibody to Marinobufagenin Reverses Placenta-Induced Fibrosis of Umbilical Arteries in Preeclampsia

Background: Previous studies implicated cardiotonic steroids, including Na/K-ATPase inhibitor marinobufagenin (MBG), in the pathogenesis of preeclampsia (PE). Immunoneutralization of heightened MBG by Digibind, a digoxin antibody, reduces blood pressure (BP) in patients with PE, and anti-MBG monoclonal antibody lessens BP in a rat model of PE. Recently, we demonstrated that MBG induces fibrosis in cardiovascular tissues via a mechanism involving inhibition of Fli-1, a nuclear transcription factor and a negative regulator of collagen-1 synthesis. Objectives and Methods: We hypothesized that in PE, elevated placental MBG levels are associated with development of fibrosis in umbilical arteries. Eleven patients with PE (mean BP 124 ± 4 mmHg; age 29 ± 2 years; 39 weeks gest. age) and 10 gestational age-matched normal pregnant subjects (mean BP 92 ± 2 mmHg; controls) were enrolled in the clinical study. Results: PE was associated with a higher placental (0.04 ± 0.01 vs. 0.49 ± 0.11 pmol/g; p < 0.01) and plasma MBG (0.5 ± 0.1 vs. 1.6 ± 0.5 nmol/L; p < 0.01), lower Na/K-ATPase activity in erythrocytes (2.7 ± 0.2 vs. 1.5 ± 0.2 µmol Pi/mL/hr; p < 0.01), 9-fold decrease of Fli-1 level and 2.5-fold increase of collagen-1 in placentae (p < 0.01) vs. control. Incubation of umbilical arteries from control patients with 1 nmol/L MBG was associated with four-fold decrease in Fli-1 level and two-fold increase in collagen-1 level vs. those incubated with placebo (p < 0.01), i.e., physiological concentration of MBG mimicked effect of PE in vitro. Collagen-1 abundance in umbilical arteries from PE patients was 4-fold higher than in control arteries, and this PE-associated fibrosis was reversed by monoclonal anti-MBG antibody ex vivo. Conclusion: These results demonstrate that elevated placental MBG level is implicated in the development of fibrosis of the placenta and umbilical arteries in PE

Sulfur Concrete with Ash Waste

В статье представлены результаты по получению и исследованию бетонов на основе серного вяжущего. В качестве модификаторов для серного вяжущего предложены высококальциевые зольные отходы ТЭЦ Красноярского края. Проведены исследования поведения серного вяжущего при нагреве, определены прочность и морозостойкость серобетонов. Показано, что использование зольных отходов позволяет получать низкопористые и однородные по структуре материалы с высокими физико-механическими и эксплуатационными характеристикамиResult for synthesis and researching concrete base on sulfur is shown in this work. Sulfur concrete was modified ash waste from thermal power station of Krasnoyarsk with a high concentration of calcium oxide. Sulfur concrete was investigated during heating and strength and frost resistance was measured. Sulfur concrete with ash waste has low porosity, high physic mechanical and performance propertie

Sulfur Concrete with Ash Waste

В статье представлены результаты по получению и исследованию бетонов на основе серного вяжущего. В качестве модификаторов для серного вяжущего предложены высококальциевые зольные отходы ТЭЦ Красноярского края. Проведены исследования поведения серного вяжущего при нагреве, определены прочность и морозостойкость серобетонов. Показано, что использование зольных отходов позволяет получать низкопористые и однородные по структуре материалы с высокими физико-механическими и эксплуатационными характеристикамиResult for synthesis and researching concrete base on sulfur is shown in this work. Sulfur concrete was modified ash waste from thermal power station of Krasnoyarsk with a high concentration of calcium oxide. Sulfur concrete was investigated during heating and strength and frost resistance was measured. Sulfur concrete with ash waste has low porosity, high physic mechanical and performance propertie

Adenosine A1 Receptors and Microglial Cells Mediate CX3CL1-Induced Protection of Hippocampal Neurons Against Glu-Induced Death

Fractalkine/CX3CL1 is a neuron-associated chemokine, which modulates microglia-induced neurotoxicity activating the specific and unique receptor CX3CR1. CX3CL1/CX3CR1 interaction modulates the release of cytokines from microglia, reducing the level of tumor necrosis factor-α, interleukin-1-β, and nitric oxide and induces the production of neurotrophic substances, both in vivo and in vitro. We have recently shown that blocking adenosine A1 receptors (A1R) with the specific antagonist 1,3-dipropyl-8-cyclopentylxanthine (DPCPX) abolishes CX3CL1-mediated rescue of neuronal excitotoxic death and that CX3CL1 induces the release of adenosine from microglia. In this study, we show that the presence of extracellular adenosine is mandatory for the neurotrophic effect of CX3CL1 as reducing adenosine levels in hippocampal cultures, by adenosine deaminase treatment, strongly impairs CX3CL1-mediated neuroprotection. Furthermore, we confirm the predominant role of microglia in mediating the neuronal effects of CX3CL1, because the selective depletion of microglia from hippocampal cultures treated with clodronate-filled liposomes causes the complete loss of effect of CX3CL1. We also show that hippocampal neurons obtained from A1R−/− mice are not protected by CX3CL1 whereas A2AR−/− neurons are. The requirement of functional A1R for neuroprotection is not unique for CX3CL1 as A1R−/− hippocampal neurons are not rescued from Glu-induced cell death by other neurotrophins such as brain-derived neurotrophic factor and erythropoietin, which are fully active on wt neurons