4,553 research outputs found
Efficient cloning system for construction of gene silencing vectors in Aspergillus niger
An approach based on Gateway recombination technology to efficiently construct silencing vectors was developed for use in the biotechnologically important fungus Aspergillus niger. The transcription activator of xylanolytic and cellulolytic genes XlnR of A. niger was chosen as target for gene silencing. Silencing was based on the expression vector pXLNRir that was constructed and used in co-transformation. From all the strains isolated (N = 77), nine showed poor xylan-degrading activities in two semi-quantitative plate assays testing different activities for xylan degradation. Upon induction on D-xylose, transcript levels of xlnR were decreased in the xlnR-silenced strains, compared to a wild-type background. Under these conditions, the transcript levels of xyrA and xynB (two genes regulated by XlnR) were also decreased for these xlnR-silenced strains. These results indicate that the newly developed system for rapid generation of silencing vectors is an effective tool for A. niger, and this can be used to generate strains with a tailored spectrum of enzyme activities or product formation by silencing specific genes encoding, e.g., regulators such as Xln
The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis
The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos
Continuous-flow IRMS technique for determining the 17O excess of CO2 using complete oxygen isotope exchange with cerium oxide
This paper presents an analytical system for analysis of all single
substituted isotopologues (<sup>12</sup>C<sup>16</sup>O<sup>17</sup>O,
<sup>12</sup>C<sup>16</sup>O<sup>18</sup>O, <sup>13</sup>C<sup>16</sup>O<sup>16</sup>O) in nanomolar quantities
of CO<sub>2</sub> extracted from stratospheric air samples. CO<sub>2</sub> is
separated from bulk air by gas chromatography and CO<sub>2</sub> isotope ratio
measurements (ion masses 45 / 44 and 46 / 44) are performed using isotope ratio
mass spectrometry (IRMS). The <sup>17</sup>O excess (Δ<sup>17</sup>O) is
derived from isotope measurements on two different CO<sub>2</sub> aliquots:
unmodified CO<sub>2</sub> and CO<sub>2</sub> after complete oxygen isotope exchange with
cerium oxide (CeO<sub>2</sub>) at 700 °C. Thus, a single measurement of
Δ<sup>17</sup>O requires two injections of 1 mL of air with a CO<sub>2</sub>
mole fraction of 390 μmol mol<sup>−1</sup> at 293 K and 1 bar pressure
(corresponding to 16 nmol CO<sub>2</sub> each). The required sample size
(including flushing) is 2.7 mL of air. A single analysis (one pair of
injections) takes 15 minutes. The analytical system is fully automated for
unattended measurements over several days. The standard deviation of the
<sup>17</sup>O excess analysis is 1.7‰. Multiple
measurements on an air sample reduce the measurement uncertainty, as
expected for the statistical standard error. Thus, the uncertainty for a
group of 10 measurements is 0.58‰ for Δ
<sup>17</sup>O in 2.5 h of analysis. 100 repeat analyses of one air sample
decrease the standard error to 0.20‰. The instrument
performance was demonstrated by measuring CO<sub>2</sub> on stratospheric air
samples obtained during the EU project RECONCILE with the high-altitude
aircraft Geophysica. The precision for RECONCILE data is 0.03‰ (1σ) for δ<sup>13</sup>C, 0.07‰ (1σ) for δ<sup>18</sup>O and 0.55‰ (1σ) for δ<sup>17</sup>O for a sample of 10
measurements. This is sufficient to examine stratospheric enrichments, which
at altitude 33 km go up to 12‰ for δ<sup>17</sup>O
and up to 8‰ for δ<sup>18</sup>O with respect to
tropospheric CO<sub>2</sub> : δ<sup>17</sup>O ~
21‰ Vienna Standard Mean Ocean Water (VSMOW), δ<sup>18</sup>O ~
41‰ VSMOW (Lämmerzahl et al., 2002). The samples
measured with our analytical technique agree with available data for
stratospheric CO<sub>2</sub>
Evaluatie landbouwvrijstelling
Landbouwgrond neemt in de agrarische sector een bijzondere positie in. Zonder grond is de bedrijfsuitoefening ondenkbaar. Boekwinsten op landbouwgrond zijn onder de landbouwvrijstelling onder bepaalde condities vrijgesteld. In deze evaluatie wordt onderzocht of de landbouwvrijstelling op een doeltreffende (effectieve) en doelmatige (efficiënte) manier leidt tot het bereiken van de geformuleerde doelstelling. Daarnaast wordt aandacht besteed aan de neveneffecten van de regeling
Speckle interferometry and radiative transfer modelling of the Wolf-Rayet star WR 118
WR 118 is a highly evolved Wolf-Rayet star of the WC10 subtype surrounded by
a permanent dust shell absorbing and re-emitting in the infrared a considerable
fraction of the stellar luminosity. We present the first diffraction-limited
2.13micron speckle interferometric observations of WR 118 with 73 mas
resolution. The speckle interferograms were obtained with the 6m telescope at
the Special Astrophysical Observatory. The two-dimensional visibility function
of the object does not show any significant deviation from circular symmetry.
The visibility curve declines towards the diffraction cut-off frequency to 0.66
and can be approximated by a linear function. Radiative transfer calculations
have been carried out to model the spectral energy distribution, given in the
range of 0.5-25micron, and our 2.13micron visibility function, assuming
spherical symmetry of the dust shell. Both can be fitted with a model
containing double-sized grains (``small'' and ``large'') with the radii of a =
0.05micron and 0.38micron, and a mass fraction of the large grains greater than
65%. Alternatively, a good match can be obtained with the grain size
distribution function n(a)~a^-3, with a ranging between 0.005micron and
0.6micron. At the inner boundary of the modelled dust shell (angular diameter
(17 +/- 1)mas), the temperature of the smallest grains and the dust shell
density are 1750K +/- 100K and (1 +/- 0.2)x10^-19 g/cm^3, respectively. The
dust formation rate is found to be (1.3 +/- 0.5)x10^-7 Msol/yr assuming Vwind =
1200 km/s.Comment: 6 pages including 4 PostScript figures, also available from
http://www.mpifr-bonn.mpg.de/div/ir-interferometry/publications.html;
accepted for publication in Astronomy & Astrophysic
Evaluatie van de landbouwregeling in de omzetbelasting
In artikel 27 Wet OB 1968 is de landbouwregeling uitgewerkt. Landbouwers, veehouders, tuinbouwers en bosbouwers zijn over prestaties genoemd in dit artikel geen omzetbelasting verschuldigd, maar hebben ook geen recht op aftrek van voorbelasting. De ondernemer kan opteren om in de heffing van de omzetbelasting te worden betrokken als een normale ondernemer. In deze evaluatie wordt onderzocht of de landbouwregeling op een doeltreffende (effectieve) en doelmatige (efficiënte) manier leidt tot het bereiken van de geformuleerde doelstelling. Daarnaast wordt aandacht besteed aan de neveneffecten van de regeling
Report of the workshop on multi-level environmental governance relationship between domestic, supranational and international policy making and law: The problem of scale
Evaluatie van vrijstellingen voor de landbouw in de overdrachtsbelasting
In dit rapport wordt een zestal voor de agrarische sector relevante vrijstellingen in artikel 15, eerste lid van de Wet op belastingen van Rechtsverkeer (WBR) geëvalueerd. De vrijstellingen zorgen ervoor dat de aankoop van landbouwgrond onder bepaalde voorwaarden onbelast is met 6% overdrachtsbelasting. In de evaluatie wordt per vrijstelling onderzocht of de regeling op een doeltreffende en doelmatige manier leidt tot het bereiken van de geformuleerde doelstellingen. Daarnaast wordt aandacht besteed aan de neveneffecten van de regeling
Transcriptional profiling of Aspergillus niger
The industrially important fungus Aspergillus niger feeds naturally on decomposing plant material, of which a significant proportion is lipid. Examination of the A. niger genome sequence suggested that all proteins required for metabolic conversion of lipids are present, including 63 predicted lipases. In contrast to polysaccharide-degrading enzyme networks, not much is known about the signaling and regulatory processes that control lipase expression and activity in fungi. This project was aimed to gain better understanding of lipid degradation mechanisms and how this process is regulated in A. niger, primarily via assessment of its gene transcription levels. Minimizing biological and technical variation is crucial for experiments in which transcription levels are determined, such as microarray and quantitative real-time PCR experiments. However, A. niger is difficult to cultivate in a reproducible way due to its filamentous growth. In addition, the complex processing steps of transcriptomics technologies add non-experimental variation to the biological variation. To reduce this data noise, robust protocols based on a batch-fermentation setup were developed. Variation in this setup was surveyed by examining the fungal transcriptional response towards a pulse of D-xylose. The sources of non-experimental variation were described by variance components analysis. Two-thirds of total variation stems from differences in routine handling of fermentations, but in absolute terms this variation is low. As D-xylose is an inducer of the xylanolytic system, the high reproducibility of cultures for the first time allowed a detailed description of the global fungal transcriptional response towards D-xylose using microarrays. The transcriptional response towards three plant derived oils was examined in another study. Both olive oil and a wheat-gluten extracted oil induce the transcription of genes involved in lipid metabolism and peroxisome assembly, albeit with different expression profiles. The third oil, a plant membrane lipid, did not trigger a transcriptional response. Microarray data are related to the physiology of the fungus. To better understand the general principles that underlie gene regulation and gene transcription, microarray data from cultures grown under mildly and strongly perturbed conditions were analyzed for co-expression of genes. Despite the diverse culturing conditions, co-expressed gene modules could be identified. Some of these modules can be related to biological functions. For some modules, conserved promoter elements were identified, which suggests that genes in these modules are regulated on a transcriptional level. The work described in this thesis shows that (i) high-quality -omics data for A. niger can be generated; that (ii) analysis and interpretation of these data enhances our understanding of the xylanolytic and lipid metabolic regulons; and (iii) that these data give insight into the regulatory mechanisms of this fungus. <br/
- …
