A new projection method for finding the closest point in the intersection of convex sets

In this paper we present a new iterative projection method for finding the closest point in the intersection of convex sets to any arbitrary point in a Hilbert space. This method, termed AAMR for averaged alternating modified reflections, can be viewed as an adequate modification of the Douglas--Rachford method that yields a solution to the best approximation problem. Under a constraint qualification at the point of interest, we show strong convergence of the method. In fact, the so-called strong CHIP fully characterizes the convergence of the AAMR method for every point in the space. We report some promising numerical experiments where we compare the performance of AAMR against other projection methods for finding the closest point in the intersection of pairs of finite dimensional subspaces

A feasibility approach for constructing combinatorial designs of circulant type

In this work, we propose an optimization approach for constructing various classes of circulant combinatorial designs that can be defined in terms of autocorrelations. The problem is formulated as a so-called feasibility problem having three sets, to which the Douglas-Rachford projection algorithm is applied. The approach is illustrated on three different classes of circulant combinatorial designs: circulant weighing matrices, D-optimal matrices, and Hadamard matrices with two circulant cores. Furthermore, we explicitly construct two new circulant weighing matrices, a $CW(126,64)$ and a $CW(198,100)$, whose existence was previously marked as unresolved in the most recent version of Strassler's table

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

Thermodynamic modeling of phase separation in manganites

We present a phenomenological model based on the thermodynamics of the phase separated state of manganites, accounting for its static and dynamic properties. Through calorimetric measurements on La$_{0.225}$Pr$_{0.40}$Ca$_{0.375}$MnO$_{3}$ the low temperature free energies of the coexisting ferromagnetic and charge ordered phases are evaluated. The phase separated state is modeled by free energy densities uniformly spread over the sample volume. The calculations contemplate the out of equilibrium features of the coexisting phase regime, to allow a comparison between magnetic measurements and the predictions of the model. A phase diagram including the static and dynamic properties of the system is constructed, showing the existence of blocked and unblocked regimes which are characteristics of the phase separated state in manganites.Comment: 7 pages, 5 figures, Submitted to Phys. Rev.

Propuestas de "e-orientación" para una educación intercultural

La llegada masiva de alumnos procedentes de otras culturas, religiones, razas, etc. está generando en los centros educativos y en la sociedad una serie de necesidades a las que habrá que dar respuesta decidida en los próximos años. La educación intercultural se constituirá en uno de los pilares básicos sobre los que asentarán las iniciativas institucionales y privadas. Una forma de dar respuesta a las demandas que se están produciendo proviene de las redes telemáticas y sus aplicaciones a la orientación. La e-orientación puede fortalecer los procesos de integración social y mejorar la calidad de la adaptación._________________________________The massive arrival of pupils coming from other cultures, religions, races, etc. is bringing about some necessities in the educational centers and in the society that we have to try to solve in the next years. The intercultural education will become one of the essential supports for institutional and privates initiatives. A response to this demand comes from the telematic nets and their applications to the guidance which can strengthen the process of social integration and improve the quality for the adaptation

El orientador ante las nuevas tecnologías

Las Nuevas Tecnologías de la Información y la Comunicación (NTIC) están hoy en todos los ámbitos de la sociedad. Continuamente aparecen más y mejores desarrollos que acercan las mismas a las disciplinas más dispares. La orientación educativa y la labor del orientador se enfrentan de manera permanente a nuevos retos que precisan de una adaptación de los roles y funciones de los mismos a las demandas de una sociedad tecnologizada. Los planes de estudio cuentan con pocas opciones relacionadas con el tema (formación inicial) y los Centros de Profesorado casi no ofertan cursos (formación continua) en los que se relacionen las NTIC y la orientación. Un panorama nada esperanzador sobre el que apenas si contamos con estudios de referencia. Este fue el motivo de que planteáramos la investigación que presentamos en el presente artículo, conocer la opinión que tienen los orientadores de la provincia de Jaén sobre el uso de las NTIC en su labor orientadora y el uso que de las mismas se está realizando en la práctica.New Information and Communication Technologies (NICT’s) exist in all sectors of society nowadays. Continually, new and better developments appear, which bring them closer to more unalike disciplines. Educational orientation and the labour of careers adviser permanently face new challenges which precise an adaptation of their roles and functions to new demands of the technologized society. Study plans count with few options related to the topic (initial training) and Teacher’s Centres offer almost no courses (continuous training) in which NICT’s and advisement are related. It is not a promising panorama if we do not count with baseline studies. Knowing careers advisers’ opinion from the province of Jaén about the use of NICT’s in its advising labour and their use in practice was the motive that made us lay out the investigation present in this article

Study of the optical behavior of skins using Monte Carlo techniques

Uno de los principales retos en óptica biomédica y en biofotónica es la simulación de la propagación de la luz en los tejidos biológicos. El método de Monte Carlo es la aproximación más empleada, y se puede afirmar que constituye un estándar por su flexibilidad y fiabilidad en modelar la geometría de un tejido heterogéneo. Este trabajo muestra cómo analizar el comportamiento óptico de la piel y cómo algunas de las deducciones extraídas de este análisis pueden aportar información para el diagnóstico y el tratamiento de pieles. Se han aplicado las propiedades ópticas de pieles sanas de diferentes razas y, como alteración posible en la piel, se ha estudiado la presencia del basalioma. Los resultados nos ofrecen un método para distinguir entre piel «sana» y piel «enferma», lo que podría facilitar un procedimiento de identificación de pieles cancerígenas. Del estudio de los distintos tipos de pieles sanas se desprende, además, un ejemplo de aplicación inmediata que se beneficia del conocimiento adquirido por los valores obtenidos (fotodepilación). En este trabajo se presentan los resultados más significativos de los programas de simulación basados en técnicas de Monte Carlo, que permiten estudiar el comportamiento de la piel frente a una radiación óptica. La aproximación a la trayectoria que sigue la luz en su interacción con el tejido se obtiene a partir de las propiedades ópticas conocidas a priori. Se realiza una aproximación general al tema, identificando los principales problemas que se plantean en este tipo de estudios y se emplea un programa comercial.In both biomedical optics and biophotonics, one of the main challengers is the simulation of light spread in biological tissues. The approximation which is most used is Monte Carlos method; it is a standard because of its flexibility and its reliability modeling heterogeneous tissues. This paper shows how to analyse the optical behaviour of the skin, and how some of the deductions drawn from this analysis can add information for the diagnosis and treatment of skins. The optic qualities of healthy skins from different races have been applied; and as a possible alteration in the skin, basalioma presence has been studied. The results provide us with a method to distinguish between “healthy” and “ill” skin, which could make the procedure to identify cancer skins easier. From the study of the different healthy skins an example of immediate application also appears which benefits from the knowledge acquired from the values obtained (photodepilation). In this work the most valued results of the simulation programs based in Monte Carlos technics are presented, which allow studying the skins behaviour facing an optical radiation; the approximation to the light trajectory interacting with the tissues is obtained from the optic qualities known before. First of all, a general approach to the theme is carried out, identifying the main problems that appear in this kind of studies and a commercial programme is used.Peer Reviewe