Réaction de nitroso Diels-Alder avec des diénophiles de type alpha-acyloxynitroso en présence d'acides de Lewis (application à la synthèse de pyrroles polysubstitués et à la synthèse des clavépictines A et B)

La cycloaddition de nitroso Diels-Alder entre un diénophile de type nitroso et un diène-1,3 permet la préparation de 3,6-dihydro-1,2-oxazines et a fait l objet de nombreuses applications en synthèse de composés naturels et/ou biologiquement actifs. Nous avons développé de nouveaux diénophiles de type a-acyloxynitroso, potentiellement activables en présence d un acide de Lewis. La réaction de cycloaddition en milieu anhydre entre cet a-acyloxynitroso et un diène-1,3 conduit à un hydroxycarbamate au lieu de la dihydrooxazine attendue. Une réaction de réduction de la liaison azote-oxygène se produit de façon surprenante dans le milieu réactionnel. La réaction réalisée en présence d un acide de Lewis permet d améliorer le rendement de la réaction ainsi que la reproductibilité des résultats. La même réaction effectuée dan l eau conduit, en revanche, à une dihydrooxazine. La réaction de cycloaddition dans l eau a été généralisée à divers diénes : cycliques, acycliques et fonctionnalisés. La réaction de coupure de la liaison azote oxygène que nous avons observée dans l eau nous a permis de développer une méthode de réduction de liaisons azote oxygène en conditions douces à l aide de composés carbonylés. Nous avons également mis au point une méthode de synthèse de pyrroles polysubstitués en trois étapes à partir des dihydrooxazines préparées par la réaction de cycloaddition dans l eau. Enfin, nous avons développé une approche synthétique des clavépictines A et B faisant intervenir comme étape clé une réaction de transposition de cycle catalysée par des complexes carbéniques de ruthénium.We have developed a-acyloxynitroso as a new type of reactive dienophile in the nitroso Diels-Alder cycloaddition. a-Acyloxynitrosos are conveniently synthesized from the corresponding oxime in good yield. The cycloaddition with a 1,3-diene and 0 or 20 mol% of a Lewis acid lead to an hydroxycarbamate instead of the expected dihydrooxazine resulting formally from the N-O bond.We have studied the nitroso Diels-Alder cycloaddition of a-acyloxynitroso dienophile in aqueous medium.Under these conditions, the cycloaddition reaction led exclusively to the cycloadduct. Various 1,3-dienes were evaluated under optimized conditions, the corresponding dihydrooxazines were obtained in good yield Among the different strategies known for the elaboration of dihydrooxazines by nitroso Diels-Alder cycloaddition, this methodology presents the advantage of being flexible, allowing a straightforward access to dihydrooxazine in aqueous medium or the corresponding N-O bond cleaved product in anhydrous solvent. Finally, we have exploited the cycloadducts obtained in these previous studies in the synthesis of polysubstituted pyrroles. These cycloadducts can be viewed as latent pyrroles : N-O bond cleavage followed by oxydation reaction of the resulting hydroxycarbamate lead to polysubstituted pyrroles. The application of this methodology to the synthesis of clavepictine, a secondary metabolite of the Bermudian tunicate Clavelina picta is currently underway, using as key steps the cycloaddition of an acetoxynitroso dienophile in water followed by a ring rearrangement metathesis.ORSAY-PARIS 11-BU Sciences (914712101) / SudocSudocFranceF

Palladium-Catalyzed Synthesis of 2,3-Disubstituted 5-Azaindoles via Heteroannulation Reaction and of 2-Substituted 5-Azaindoles through Domino Sila-Sonogashira/5-Endo Cyclization

International audienc

Data from: Optimizing detectability of the endangered fan mussel using eDNA and ddPCR

<p>Spatial and temporal monitoring of species threatened with extinction is of critical importance for conservation and ecosystem management. On the Mediterranean coast, the fan mussel (<em>Pinna nobilis</em>) is listed as critically endangered after suffering from a mass mortality event since 2016, leading to 100% mortality in most marine populations. Conventional monitoring for this macroinvertebrate is done using scuba, which is challenging in dense meadows or with low visibility. Here we developed an environmental DNA assay targeting the fan mussel and assessed the influence of several environmental parameters on the species detectability <em>in situ</em>. We developed and tested an eDNA molecular marker and collected 48 water samples in two sites at the Thau lagoon (France) with distinct fan mussel density, depths, and during two seasons (summer and autumn). Our marker can amplify fan mussel DNA but lacks specificity since it also amplifies a conspecific species (<em>Pinna rudis</em>). We successfully amplified fan mussel DNA from <em>in situ</em> samples with 46 positive samples (out of 48) using ddPCR, although the DNA concentrations measured were low over almost all samples. Deeper sampling depth slightly increased DNA concentrations, but no seasonal effect was found. We highlight a putative spawning event on a single summer day with much higher DNA concentration compared to all other samples. We present an eDNA molecular assay able to detect the endangered fan mussel and provide guidelines to optimize the sampling protocol to maximize detectability. Effective and non-invasive monitoring tools for endangered species are promising to monitor remaining populations and have the potential for ecological restoration or habitat recolonisation following a mass mortality event.</p><p>Funding provided by: FEDER<br>Crossref Funder Registry ID: http://dx.doi.org/10.13039/501100002924<br>Award Number: CONAQUAT</p><ul> <li>Assay development</li> </ul> <p>Reference sequences on the mitochondrial genome were downloaded for <em>P.nobilis</em> and co-occurring related species of the same family (<em>Pinna rudis</em> and <em>Atrina fragilis</em>) from EMBL (Kanz et al. 2005), and aligned using Geneious Prime 2020 (<a href="https://www.geneious.com/">https://www.geneious.com/</a>). Primer selection was done by maximizing specificity on the binding sites for the target species while maximizing the number of mismatches of ligation sites of closely related species. Primers were designed manually with the assistance of the primer3 algorithm on Geneious and amplified a sequence insert of ~202 bp on the mitochondrial COI gene for <em>P.nobilis (Supl Mat Table S1)</em>, the full amplified sequence being ~243 pb. The selected primer pair (PN_COI_M15; forward-TCAGCTTTTGTAGAGGGCGG; reverse- AGAGACTACCAACAGCACAGC) was also tested on the entire NCBI database using in-silico PCR with the ecoPCR software (Boyer et al., 2016) allowing up to 3 mismatches on each primer (so 6 in total), to verify the absence of unrelated species cross-amplification. Additionally, a probe (PN_COIM15-Probe; FAM-5' TGGATTTGTTCCCTTGGGCTGTTC 3'- BHQ1) was designed to enhance specificity using the Primer3Plus software (Untergasser et al. 2012).</p> <ul> <li>Sampling for eDNA</li> </ul> <p>DNA sampling aimed to first collect live fan mussel from an aquarium and then sample water in real field condition in a Mediterranean lagoon with known populations of fan mussel.</p> <p>We sampled water in the field with known presence and densities of fan mussels in the Thau lagoon (Sète, France) (Foulquie et al. 2020), one of the last known locations to harbor healthy mussel populations in France. Sampling sites were chosen from the study of Foulquie et al. (2020) which assessed fan mussel densities in several sites around the lagoon 3 months prior to our sampling. We selected sites with at least 3m of depth and varying densities: the Barrou (~9 ind/100m<sup>2</sup>) and the Sete Canal (~4 ind/100m<sup>2</sup>) (Fig. 1). Maximum depth of those sites was ~2.5m. We filtered water from a boat using the same pump and settings as for the aquaria samples but made linear transects of ~300m over the site area, for a total of 30L per sample. Transects were made at low speed (5 knots) and by going back and forth to remain in the area, with one pump on each side of the boat and using disposable tubing and gloves. Surface samples were done at ~0.5m of the surface with short tubes, and deeper samples were done to target the benthos using 3m-long weighted tubes. We chose to sample seasonally during Summer and Autumn to encompass various environmental conditions and test a potential effect of the reproduction period, known to occur during the summer months. We collected a total of 48 samples, with 24 samples over two days in summer in July (2020-07-27 and 2020-07-30), and 24 samples over two days in autumn in October (2020-10-20 and 2020-10-21). Each day, 12 samples were collected spanning both sites and two sampling depths (bottom and surface), so that three replicates were obtained for each site-depth combination.</p> <ul> <li>eDNA extraction and amplification by ddPCR</li> </ul> <p><strong>DNA extraction</strong></p> <p>DNA extraction was performed at SPYGEN (Le Bourget du Lac, France) following the protocol described in Polanco Fernández et al., (2020), in a dedicated lab for eDNA extraction with UV treatment and positive air pressure. Briefly, each capsule was agitated for 15 min on an S50 shaker (cat Ingenieurbüro™) at 800 rpm. The buffer was then emptied into two 50-ml tubes before being centrifuged for 15 min at 15,000 g. The supernatant was removed with a sterile pipette, leaving 15 ml of liquid at the bottom of each tube. Then, 33 ml of ethanol and 1.5 ml of 3 M sodium acetate were added to each 50-ml tube and stored for at least one night at −20°C. The tubes were centrifuged at 15,000 g for 15 min at 6°C, and the supernatants were discarded. After this step, 720 μl of ATL buffer from Qiagen Blood and Tissue Kit(Qiagen GmbH) was added to each tube. Each tube was then vortexed, and the supernatant was transferred to a 2-ml tube containing 20 μl of Proteinase K. The tubes were finally incubated at 56°C for 2 hr. Subsequently, DNA extraction was performed using NucleoSpin® Soil (MACHEREY-NAGEL GmbH & Co.) starting from step 6 and following the manufacturer's instructions, and two DNA extractions were carried out per filtration capsule. The elution was performed by adding 100 μl of SE buffer twice. The two DNA samples were pooled before the amplification step. After the DNA extraction, the samples were tested for inhibition by qPCR (Biggs et al. 2015). If the sample was considered inhibited, it was diluted 5-fold before amplification.</p> <p><strong>Amplification with ddPCR</strong></p> <p>ddPCRs were run with a BioRad QX200 Droplet Digital PCR system™ (Bio-Rad, Temse, Belgium). Each 22 μl ddPCR reaction mix contained 1× Bio-Rad ddPCR supermix for probes (no dUTP), 900 nM forward primer, 900 nM reverse primer, 250 nM probe, 2,5 μl template, and 3,99 μl H20. ddPCR reaction was placed in a QX200 Droplet Generator to generate approximately 20000 droplets in which independent PCR reactions occur.PCR was performed with the following thermal conditions: 95°C for 10 min followed by 40 cycles of 95°C for 30s and 58°C for 1 min; and 98°C for 10 min and 4°C for 30 min. Optimal annealing temperature (58°C) was determined based on an initial thermal gradient experiment testing temperatures from 54 to 64°C. Droplets were then read on a QX200 droplet reader (Bio-Rad). Each run included 3 PCR positive and 3 PCR negative controls and samples were tested in triplicate (N=3). QuantaSoft software was used to count the PCR-positive and PCR-negative droplets and to provide absolute quantification of target DNA. The baseline threshold for separating positive and negative droplets was manually chosen per run, based on the distribution of the negative droplets from the negative control wells. The quantification measurements of each target were expressed as the copies number per 1 μl of reaction.</p> <ul> <li>Analysis</li> </ul> <p>Amplification results from ddPCR were analyzed both considering the number of positive replicates among the 3 replicates per sample and quantitatively using the number of copies per µL. Repeatability by sample between the PCR replicates was assessed with the R package rptR (Stoffel et al. 2017). The average number of copies per µL measured with ddPCR were related to site, depth and season using a General Linear Model (GLM). We used a Poisson distribution to model the average number of copies per µL among the 3 replicates for each sample. We added a dummy variable representing a putative reproduction event on a particular summer sampling day.</p&gt

Optimizing detectability of the endangered fan mussel using eDNA and ddPCR

International audienceSpatial and temporal monitoring of species threatened with extinction is of critical importance for conservation and ecosystem management. In the Mediterranean coast, the fan mussel (Pinna nobilis) is listed as critically endangered after suffering from a mass mortality event since 2016, leading to 100% mortality in most marine populations. Conventional monitoring for this macroinvertebrate is done using scuba, which is challenging in dense meadows or with low visibility. Here we developed an environmental DNA assay targeting the fan mussel and assessed the influence of several environmental parameters on the species detectability in situ. We developed and tested an eDNA molecular marker and collected 48 water samples in two sites at the Thau lagoon (France) with distinct fan mussel density, depths and during two seasons (summer and autumn). Our marker can amplify fan mussel DNA but lacks specificity since it also amplifies a conspecific species (Pinna rudis). We successfully amplified fan mussel DNA from in situ samples with 46 positive samples (out of 48) using ddPCR, although the DNA concentrations measured were low over almost all samples. Deeper sampling depth slightly increased DNA concentrations, but no seasonal effect was found. We highlight a putative spawning event on a single summer day with much higher DNA concentration compared to all other samples. We present an eDNA molecular assay able to detect the endangered fan mussel and provide guidelines to optimize the sampling protocol to maximize detectability. Effective and non-invasive monitoring tools for endangered species are promising to monitor remaining populations and have the potential of ecological restoration or habitat recolonization following a mass mortality event

Ecosystem Services and Institutional Dynamics

This Special Issue on “Ecosystem Services and Institutional Dynamics” is composed of a selection of papers which were originally presented during the 10th biennial conference of the European Society for Ecological Economics held in June 2013 in Lille. Ecosystem services, i.e. the material and immaterial benefits people obtain from ecosystems, has become a topic of increasing attention, over the past two decades, from both scientists and policy makers. This enthusiasm for such a concept can be understood, as an ideological option (commodification of nature), a pragmatic view at the (best) ways to conduct policies dealing with human–nature interactions—focusing on human well-being—or simply as a tool which has to find its place in the already existing toolbox. Various valuation methods have been developed or adapted to ecosystem services, ranging from monetary valuation to more sophisticated valuation/quantification methods taking into account more directly the incommensurable nature of human and natural capital (deliberative monetary valuation, multi-criteria analysis, integrated assessment). In parallel, an important development of policy instruments incorporating ecosystem services has been witnessed in recent years,. This Special Issue will deconstruct discourses and explore practices on the ground on all the above mentioned topics

Effect of general anaesthesia on functional outcome in patients with anterior circulation ischaemic stroke having endovascular thrombectomy versus standard care: a meta-analysis of individual patient data

Background: General anaesthesia (GA) during endovascular thrombectomy has been associated with worse patient outcomes in observational studies compared with patients treated without GA. We assessed functional outcome in ischaemic stroke patients with large vessel anterior circulation occlusion undergoing endovascular thrombectomy under GA, versus thrombectomy not under GA (with or without sedation) versus standard care (ie, no thrombectomy), stratified by the use of GA versus standard care. Methods: For this meta-analysis, patient-level data were pooled from all patients included in randomised trials in PuMed published between Jan 1, 2010, and May 31, 2017, that compared endovascular thrombectomy predominantly done with stent retrievers with standard care in anterior circulation ischaemic stroke patients (HERMES Collaboration). The primary outcome was functional outcome assessed by ordinal analysis of the modified Rankin scale (mRS) at 90 days in the GA and non-GA subgroups of patients treated with endovascular therapy versus those patients treated with standard care, adjusted for baseline prognostic variables. To account for between-trial variance we used mixed-effects modelling with a random effect for trials incorporated in all models. Bias was assessed using the Cochrane method. The meta-analysis was prospectively designed, but not registered. Findings: Seven trials were identified by our search; of 1764 patients included in these trials, 871 were allocated to endovascular thrombectomy and 893 were assigned standard care. After exclusion of 74 patients (72 did not undergo the procedure and two had missing data on anaesthetic strategy), 236 (30%) of 797 patients who had endovascular procedures were treated under GA. At baseline, patients receiving GA were younger and had a shorter delay between stroke onset and randomisation but they had similar pre-treatment clinical severity compared with patients who did not have GA. Endovascular thrombectomy improved functional outcome at 3 months both in patients who had GA (adjusted common odds ratio (cOR) 1·52, 95% CI 1·09–2·11, p=0·014) and in those who did not have GA (adjusted cOR 2·33, 95% CI 1·75–3·10, p<0·0001) versus standard care. However, outcomes were significantly better for patients who did not receive GA versus those who received GA (covariate-adjusted cOR 1·53, 95% CI 1·14–2·04, p=0·0044). The risk of bias and variability between studies was assessed to be low. Interpretation: Worse outcomes after endovascular thrombectomy were associated with GA, after adjustment for baseline prognostic variables. These data support avoidance of GA whenever possible. The procedure did, however, remain effective versus standard care in patients treated under GA, indicating that treatment should not be withheld in those who require anaesthesia for medical reasons