Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments

Molecular dynamics simulation study of parallel telomeric DNA quadruplexes at different ionic strengths: evaluation of water and ion models

Most molecular dynamics (MD) simulations of DNA quadruplexes have been performed under minimal salt conditions using the Åqvist potential parameters for the cation with the TIP3P water model. Recently, this combination of parameters has been reported to be problematic for the stability of quadruplex DNA, especially caused by the ion interactions inside or near the quadruplex channel. Here, we verify how the choice of ion parameters and water model can affect the quadruplex structural stability and the interactions with the ions outside the channel. We have performed a series of MD simulations of the human full-parallel telomeric quadruplex by neutralizing its negative charge with K+ ions. Three combinations of different cation potential parameters and water models have been used: (a) Åqvist ion parameters, TIP3P water model; (b) Joung and Cheatham ion parameters, TIP3P water model; and (c) Joung and Cheatham ion parameters, TIP4Pew water model. For the combinations (b) and (c), the effect of the ionic strength has been evaluated by adding increasing amounts of KCl salt (50, 100, and 200 mM). Two independent simulations using the Åqvist parameters with the TIP3P model show that this combination is clearly less suited for the studied quadruplex with K+ as counterions. In both simulations, one ion escapes from the channel, followed by significant deformation of the structure, leading to deviating conformation compared to that in the reference crystallographic data. For the other combinations of ion and water potentials, no tendency is observed for the channel ions to escape from the quadruplex channel. In addition, the internal mobility of the three loops, torsion angles, and counterion affinity have been investigated at varied salt concentrations. In summary, the selection of ion and water models is crucial as it can affect both the structure and dynamics as well as the interactions of the quadruplex with its counterions. The results obtained with the TIP4Pew model are found to be closest to the experimental data at all of the studied ion concentrations

Computational study of the mechanism of Bcl-2 apoptotic switch

Programmed cell death - apoptosis is one of the most studied biological phenomenon of recent years. Apoptotic regulatory network contains several significant control points, including probably the most important one - Bcl--2 apoptotic switch. There are two proposed hypotheses regarding its internal working - the indirect activation and direct activation models. Since these hypotheses form extreme poles of full continuum of intermediate models, we have constructed more general model with these two models as extreme cases. By studying relationship between model parameters and steady-state response ultrasensitivity we have found optimal interaction pattern which reproduces behavior of Bcl-2 apoptotic switch. Our results show, that stimulus-response ultrasensitivity is negatively related to spontaneous activation of Bcl-2 effectors - subgroup of Bcl-2 proteins. We found that ultrasensitivity requires effector's activation, mediated by another subgroup of Bcl-2 proteins - activators. We have shown that the auto-activation of effectors forms ultrasensitivity enhancing feedback loop, only if mediated by monomers, but not by oligomers. Robustness analysis revealed that interaction pattern proposed by direct activation hypothesis is able to conserve stimulus-response dependence and preserve ultrasensitivity despite large changes of its internal parameters. This ability is strongly reduced as for the intermediate to indirect side of the models. Computer simulation of the more general model presented here suggest, that stimulus-response ultrasensitivity is an emergent property of the direct activation model, that cannot originate within model of indirect activation. Introduction of indirect-model-specific interactions does not provide better explanation of Bcl-2 functioning compared to direct model

Zu den Wurzeln der Modernen Architektur, Teil I

Modern emerging technologies, such as additive manufacturing, bioprinting, and new material production, require novel metrology tools to probe fundamental high-speed dynamics happening in such systems. Here we demonstrate the application of the megahertz (MHz) European X-ray Free-Electron Laser (EuXFEL) to image the fast stochastic processes induced by a laser on water-filled capillaries with micrometer-scale spatial resolution. The EuXFEL provides superior contrast and spatial resolution compared to equivalent state-of-the-art synchrotron experiments. This work opens up new possibilities for the characterization of MHz stochastic processes on the nanosecond to microsecond time scales with object velocities up to a few kilometers per second using XFEL sources

Fast Fresnel propagation through a set of inclined reflecting planes applicable for X-ray imaging

We present a fast and accurate method for wave propagation through a set of inclined reflecting planes. It is based on the coordinate transformation in reciprocal space leading to a diffraction integral, which can be calculated only by using two 2D Fast Fourier Transforms and one 2D interpolation. The method is numerically tested, and comparisons with standard methods show its superiority in both computational speed and accuracy. The direct application of this method is found in the X-ray phase contrast imaging using the Bragg magnifier—an optics consisting of crystals asymmetrically diffracting in Bragg geometry

Phase retrieval for arbitrary Fresnel-like linear shift-invariant imaging systems suitable for tomography

We present a generalization of the non-iterative phase retrieval in X-ray phase contrast imaging applicable for an arbitrary linear shift-invariant (LSI) imaging system with a non-negligible amount of free space propagation (termed as Fresnel-like). Our novel approach poses no restrictions on the propagation distance between optical elements of the system. In turn, the requirements are only demanded for the transfer function of the optical elements, which should be approximable by second-order Taylor polynomials. Furthermore, we show that the method can be conveniently used as an initial guess for iterative phase retrieval, resulting in faster convergence. The proposed approach is tested on synthetic and experimentally measured holograms obtained using a Bragg magnifier microscope -- a representative of Fresnel-like LSI imaging systems. Finally, the algorithm is applied to a whole micro-tomographic scan of a biological specimen of a tardigrade, revealing morphological details at the spatial resolution of 300 nm -- limiting resolution of the actual imaging system

Interaction of Conazole Pesticides Epoxiconazole and Prothioconazole with Human and Bovine Serum Albumin Studied Using Spectroscopic Methods and Molecular Modeling

The interactions of epoxiconazole and prothioconazole with human serum albumin and bovine serum albumin were investigated using spectroscopic methods complemented with molecular modeling. Spectroscopic techniques showed the formation of pesticide/serum albumin complexes with the static type as the dominant mechanism. The association constants ranged from 3.80 × 104–6.45 × 105 L/mol depending on the pesticide molecule (epoxiconazole, prothioconazole) and albumin type (human or bovine serum albumin). The calculated thermodynamic parameters revealed that the binding of pesticides into serum albumin macromolecules mainly depended on hydrogen bonds and van der Waals interactions. Synchronous fluorescence spectroscopy and the competitive experiments method showed that pesticides bind to subdomain IIA, near tryptophan; in the case of bovine serum albumin also on the macromolecule surface. Concerning prothioconazole, we observed the existence of an additional binding site at the junction of domains I and III of serum albumin macromolecules. These observations were corroborated well by molecular modeling predictions. The conformation changes in secondary structure were characterized by circular dichroism, three-dimensional fluorescence, and UV/VIS absorption methods

Large Scale Shear Box Testing of Interface Between Construction Materials and Soils

The interaction between soil and building structures of various materials is defined on the basis of certain assumptions, but these are shown in many cases to be not accurate from the point of view of safe, reliable and economic design of engineering structures. Therefore, as part of our research activities, we decided to better understand the transfer of shear forces and the interaction between soil and other materials. We focused on testing materials in a shear box apparatus, where 3 types of tests were carried out: in the first stage, we tested the shear parameters of the soil in a 900 mm2 box apparatus; in the second stage, the properties of the interaction between soil and concrete were tested, and in the third stage, soil was in contact with the steel plate. The results of the tests are within the expected range of the interface friction angle between the structures and the soils