Characterization and phylogenetic analysis of multidrug-resistant protein-encoding genes in Trypanosoma evansi isolated from buffaloes in Ngawi district, Indonesia

Background and Aim: Excessive use of trypanocidal drugs can lead to cases of drug resistance. Multiple cases of resistance have been widely reported for drugs such as isometamidium chloride and diminazene aceturate. These cases deserve serious attention, especially in Indonesia, where the first case was recorded and where the molecular basis of trypanocidal drug resistance has never been evaluated. This study aimed to analyze the multidrug resistance protein (MRP) gene in Trypanosoma evansi isolates, sampled from Indonesia, by focusing on the phylogenetic relationship between these isolates and other Trypanosoma spp. Materials and Methods: A total of 88 blood samples were drawn from buffaloes in the Ngawi district, Indonesia. Animals infected with T. evansi were detected through the microhematocrit technique and Giemsa blood smear methods. Positive blood samples were used to inoculate in male mice (Mus musculus BALB-C strain) as an animal model for culturing the T. evansi. The genomic DNA of the blood taken from the T. evansi-infected mice was used for polymerase chain reaction amplification, sequencing, and phylogenetic analysis. Results: Two genes were analyzed; the first gene detected for T. evansi corresponded to Trypanosoma brucei with a homology of 99% and the second gene to Trypanosoma brucei gambiense, with a homology of 100%. These two genes of the MRP from T. evansi showed clear similarity to the MRPE and MRPA genes of the T. brucei ssp. Conclusion: The MRP gene is conserved on the subspecies level of T. brucei. Only few point mutations were found between various sequences, which mean that the proteins have the same structure. This is important to treat the parasite with the appropriate drugs in the future

Analysis of the Effects of Polymorphism on Pollen Profilin Structural Functionality and the Generation of Conformational, T- and B-Cell Epitopes

An extensive polymorphism analysis of pollen profilin, a fundamental regulator of the actin cytoskeleton dynamics, has been performed with a major focus in 3D-folding maintenance, changes in the 2-D structural elements, surface residues involved in ligands-profilin interactions and functionality, and the generation of conformational and lineal B- and T-cell epitopes variability. Our results revealed that while the general fold is conserved among profilins, substantial structural differences were found, particularly affecting the special distribution and length of different 2-D structural elements (i.e. cysteine residues), characteristic loops and coils, and numerous micro-heterogeneities present in fundamental residues directly involved in the interacting motifs, and to some extension these residues nearby to the ligand-interacting areas. Differential changes as result of polymorphism might contribute to generate functional variability among the plethora of profilin isoforms present in the olive pollen from different genetic background (olive cultivars), and between plant species, since biochemical interacting properties and binding affinities to natural ligands may be affected, particularly the interactions with different actin isoforms and phosphoinositides lipids species. Furthermore, conspicuous variability in lineal and conformational epitopes was found between profilins belonging to the same olive cultivar, and among different cultivars as direct implication of sequences polymorphism. The variability of the residues taking part of IgE-binding epitopes might be the final responsible of the differences in cross-reactivity among olive pollen cultivars, among pollen and plant-derived food allergens, as well as between distantly related pollen species, leading to a variable range of allergy reactions among atopic patients. Identification and analysis of commonly shared and specific epitopes in profilin isoforms is essential to gain knowledge about the interacting surface of these epitopes, and for a better understanding of immune responses, helping design and development of rational and effective immunotherapy strategies for the treatment of allergy diseases. [EN]This study was supported by the following European Regional Development Fund co-financed grants: MCINN BFU 2004-00601/BFI, BFU 2008-00629, BFU2011-22779, CICE (Junta de Andalucía) P2010-CVI15767, P2010-AGR6274 and P2011-CVI-7487, and by the coordinated project Spain/Germany MEC HA2004-0094. JCJ-L thanks Spanish CSIC and the European Marie Curie research program for his I3P-BPD-CSIC, and PIOF-GA-2011-301550 grants, respectively.Peer reviewe

Intraperitoneal drain placement and outcomes after elective colorectal surgery: international matched, prospective, cohort study

Despite current guidelines, intraperitoneal drain placement after elective colorectal surgery remains widespread. Drains were not associated with earlier detection of intraperitoneal collections, but were associated with prolonged hospital stay and increased risk of surgical-site infections.Background Many surgeons routinely place intraperitoneal drains after elective colorectal surgery. However, enhanced recovery after surgery guidelines recommend against their routine use owing to a lack of clear clinical benefit. This study aimed to describe international variation in intraperitoneal drain placement and the safety of this practice. Methods COMPASS (COMPlicAted intra-abdominal collectionS after colorectal Surgery) was a prospective, international, cohort study which enrolled consecutive adults undergoing elective colorectal surgery (February to March 2020). The primary outcome was the rate of intraperitoneal drain placement. Secondary outcomes included: rate and time to diagnosis of postoperative intraperitoneal collections; rate of surgical site infections (SSIs); time to discharge; and 30-day major postoperative complications (Clavien-Dindo grade at least III). After propensity score matching, multivariable logistic regression and Cox proportional hazards regression were used to estimate the independent association of the secondary outcomes with drain placement. Results Overall, 1805 patients from 22 countries were included (798 women, 44.2 per cent; median age 67.0 years). The drain insertion rate was 51.9 per cent (937 patients). After matching, drains were not associated with reduced rates (odds ratio (OR) 1.33, 95 per cent c.i. 0.79 to 2.23; P = 0.287) or earlier detection (hazard ratio (HR) 0.87, 0.33 to 2.31; P = 0.780) of collections. Although not associated with worse major postoperative complications (OR 1.09, 0.68 to 1.75; P = 0.709), drains were associated with delayed hospital discharge (HR 0.58, 0.52 to 0.66; P < 0.001) and an increased risk of SSIs (OR 2.47, 1.50 to 4.05; P < 0.001). Conclusion Intraperitoneal drain placement after elective colorectal surgery is not associated with earlier detection of postoperative collections, but prolongs hospital stay and increases SSI risk

Prevalence, years lived with disability, and trends in anaemia burden by severity and cause, 1990-2021: findings from the Global Burden of Disease Study 2021

Background Anaemia is a major health problem worldwide. Global estimates of anaemia burden are crucial for developing appropriate interventions to meet current international targets for disease mitigation. We describe the prevalence, years lived with disability, and trends of anaemia and its underlying causes in 204 countries and territories. Methods We estimated population-level distributions of haemoglobin concentration by age and sex for each location from 1990 to 2021. We then calculated anaemia burden by severity and associated years lived with disability (YLDs). With data on prevalence of the causes of anaemia and associated cause-specific shifts in haemoglobin concentrations, we modelled the proportion of anaemia attributed to 37 underlying causes for all locations, years, and demographics in the Global Burden of Disease Study 2021. Findings In 2021, the global prevalence of anaemia across all ages was 24·3% (95% uncertainty interval [UI] 23·9–24·7), corresponding to 1·92 billion (1·89–1·95) prevalent cases, compared with a prevalence of 28·2% (27·8–28·5) and 1·50 billion (1·48–1·52) prevalent cases in 1990. Large variations were observed in anaemia burden by age, sex, and geography, with children younger than 5 years, women, and countries in sub-Saharan Africa and south Asia being particularly affected. Anaemia caused 52·0 million (35·1–75·1) YLDs in 2021, and the YLD rate due to anaemia declined with increasing Socio-demographic Index. The most common causes of anaemia YLDs in 2021 were dietary iron deficiency (cause-specific anaemia YLD rate per 100 000 population: 422·4 [95% UI 286·1–612·9]), haemoglobinopathies and haemolytic anaemias (89·0 [58·2–123·7]), and other neglected tropical diseases (36·3 [24·4–52·8]), collectively accounting for 84·7% (84·1–85·2) of anaemia YLDs. Interpretation Anaemia remains a substantial global health challenge, with persistent disparities according to age, sex, and geography. Estimates of cause-specific anaemia burden can be used to design locally relevant health interventions aimed at improving anaemia management and prevention. Funding Bill & Melinda Gates Foundation

Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi

This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed

The Relationship between Depression and Periodontal Indices in the Elderly in Amirkola

BACKGROUND AND OBJECTIVE: Chronic periodontitis is a slow-growing inflammatory disease that often occurs in adults. In the elderly, periodontal indices may also change due to a number of psychological factors, such as depression and consequent changes in cortisol levels. Therefore, this study was performed to investigate the relationship between depression and periodontal indices in the elderly in Amirkola, Northern Iran. METHODS: This case-control study, which is part of the second phase of the Amirkola Health and Ageing Project (AHAP) to investigate the health status of the elderly in this city, was performed on 300 elderly people. After examination, subjects were divided into two groups: periodontitis (n=100) and control (n=200). In both groups, the presence of depressive symptoms was assessed using the Geriatric Depression Scale (GDS), in which a score of 5 or higher is a sign of depression, and periodontal indices including OHIS and PDI were examined based on PDI≥4 periodontitis criterion. Then, the two groups were compared in terms of the association between periodontal indices and depression. FINDINGS: In this study, 133 were female (44.3%) and 167 were male (55.7%). 35 patients (35%) in the case group and 61 patients (30.5%) in the control group had symptoms of depression. The mean GDS score in patients with periodontitis (3.70±3.68) was slightly higher than healthy individuals (3.49±3.40), but no significant correlation was observed between GDS and PDI. Old age, male gender, lower level of education and smoking were higher in patients with periodontitis, which was statistically significant only in smoking and level of education (p=0.042 and p=0.009, respectively). In this study, a positive and weak relationship was observed between age and PDI (r=0.19 and p=0.001). CONCLUSION: The results showed that there is a relationship between periodontal indices and depression. Although it was not statistically significant, it is clinically noteworthy