Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5’CACACGGTTGTATGTCGGTTTCGCT3’ and oligo 2: 5’TCAAGGAGCTCAATGTTAC GCT3’. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia

Multicentre evaluations of two new rapid IgG4 tests (WB rapid and panLF rapid) for detection of lymphatic filariasis

In the global effort to eliminate lymphatic filariasis (LF), rapid field-applicable tests are useful tools that will allow on-site testing to be performed in remote places and the results to be obtained rapidly. Exclusive reliance on the few existing tests may jeopardize the progress of the LF elimination program, thus the introduction of other rapid tests would be useful to address this issue. Two new rapid immunochromatographic IgG4 cassette tests have been produced, namely WB rapid and panLF rapid, for detection of bancroftian filariasis and all three species of lymphatic filaria respectively. WB rapid was developed using BmSXP recombinant antigen, while PanLF rapid was developed using BmR1 and BmSXP recombinant antigens. A total of 165 WB rapid and 276 panLF rapid tests respectively were evaluated at USM and the rest were couriered to another university in Malaysia (98 WB rapid, 129 panLF rapid) and to universities in Indonesia (56 WB rapid, 62 panLF rapid), Japan (152 of each test) and India (18 of each test) where each of the tests underwent independent evaluations in a blinded manner. The average sensitivities of WB rapid and panLF rapid were found to be 97.6% (94%–100%) and 96.5% (94%–100%) respectively; while their average specificities were both 99.6% (99%–100%). Thus this study demonstrated that both the IgG4 rapid tests were highly sensitive and specific, and would be useful additional tests to facilitate the global drive to eliminate this disease

Detection Of Brugia Malayi And Brugia Pahangi Parasites By Biotinlabeled Dna Probes

Morphologically, the larvae of Brugian parasites are difficult to differentiate by conventional methods. Recently, radioactive labeled DNA probes2'3 have been developed to distinguish the larvae of these parasites. However, these probes have a short shelf-life and are hazardous to the users. Two oligonucleotide DNA probes have been tested, one is specific for B.malayi and the other specific for B.pahangi. They were each labeled with Biotin in three different ways by using : a one-tailed 30mer biotinylated uridine residues, a two-tailed 30mer biotinylated uridine-thymidine residues. The dot blot assays were tested at various temperatures (30°C-80°C) using different concentrations of parasite DNAs (12.8ng-0.1ng). Our preliminary results indicated that the sensitivity and specificity of the biotinylated DNA probes, with a two-tailed 45mer biotinylated residues, were highly acceptable for field use

A Field Study Using the Polymerase Chain Reaction (Pcr) to Screen for Brugia Microfilariae in Human and Animal Blood

Blood samples from 43 humans and 14 cats positive with Brugia microfilariae were analyzed in a field study in Tanjung Pinang, Indonesia. The study used the polymerase chain reaction (PCR) to compare the sensitivity of radioactive and biotinylated species-specific oligonuleotide probes. The cloning char­acterization of the Hha I repeat DNA family found in filarial parasites of the genus Brugia, and the development of species-specific probes for B.malayi and B.pahangi based on these repeats has been described elsewhere (PNAS USA 83: 797-801); Mol.Biochem. Parasitol. 2$: 163-170). The use of radioisotopes for labelling DNA probes is both expensive and inconvenient. To replace these probes, biotinylated DNA probes have been designed for non- radioactive detection of B.malayi and B.pahangi. These oligonucleotide probes have long tails of biotinylated uridine residues added to their 5\u27 end. As little as 100 pg of Brugia DNA can be detected on dot blot with these probes. Detection of the probes is based on an avidin-alkaline phosphatase colorimetric assay. In order to distinguish between infected from uninfected individuals, it is necessary to detect the amount of DNA in one microfilaria (about 60 pg). The polymerase chain reaction (PCR) is a procedure in which a small amount of DNA can be amplified up to 1 million-fold. A part of each sample in this study was PCR amplified and compared with the unamplified portion using both the radioactive and biotinylated DNA probe. The PCR amplified samples were accurately identified by both the radioactive and biotinylated B.malayi and B.pahangi probes. Even samples with as few as two microfilariae per lOOul of blood were easily detected. The samples that were not PCR amplified were accurately identified after only long exposures (greater than one week) to the radioactive probes. The biotinylated probes, were not sensitive enough for accurate identification of the non-PCR amplified samples. The polymerase chain reaction is, therefore, a promising new tool for enhancing the sensitivity of parasite detection assays based on DNA probes. This will be especially important in designing assay based on non-radioactive DNA probes

A rapid dipstick test for serological diagnosis of brugian filariasis: evaluation results

A total of 753 serum samples from six institutions were used to evaluate an immunochromatographic rapid dipstick test (Brugia Rapid) for diagnosis of Brugia malayi infection.The samples comprised of sera from 207 microfilaria positive individuals and 546 individuals from filaria non-endemic areas.The latter consisted of 70 individuals with soil-transmitted helminthic infections, 68 individuals with other helminthic infections, 238 individuals with protozoan infections, 12 individuals with bacterial and viral infections and 158 healthy individuals. The dipstick is lined with goat anti-mouse antibody (control line) and a B. malayi recombinant antigen (test line).First, the dipstick is dipped into a well containing diluted patient sera, thus allowing specific anti-filarial antibody in the serum to react with the recombinant antigen.Then the dipstick is placed into an adjacent well containing reconstituted anti-human IgG4-gold.After 10 minutes, development of two red-purplish lines denotes a positive result and one line indicates a negative reaction. The overall results of the evaluation showed 91% sensitivity, 99% specificity, 97% positive predictive value and 99% negative predictive value. Brugia Rapid is thus a promising diagnostic tool for detection of B. malayi infection,and would be especially useful for the brugian filariasis elimination programme

The mixed model for the analysis of a repeated‐measurement multivariate count data

Clustered overdispersed multivariate count data are challenging to model due to the presence of correlation within and between samples. Typically, the first source of correlation needs to be addressed but its quantification is of less interest. Here, we focus on the correlation between time points. In addition, the effects of covariates on the multivariate counts distribution need to be assessed. To fulfill these requirements, a regression model based on the Dirichlet‐multinomial distribution for association between covariates and the categorical counts is extended by using random effects to deal with the additional clustering. This model is the Dirichlet‐multinomial mixed regression model. Alternatively, a negative binomial regression mixed model can be deployed where the corresponding likelihood is conditioned on the total count. It appears that these two approaches are equivalent when the total count is fixed and independent of the random effects. We consider both subject‐specific and categorical‐specific random effects. However, the latter has a larger computational burden when the number of categories increases. Our work is motivated by microbiome data sets obtained by sequencing of the amplicon of the bacterial 16S rRNA gene. These data have a compositional structure and are typically overdispersed. The microbiome data set is from an epidemiological study carried out in a helminth‐endemic area in Indonesia. The conclusions are as follows: time has no statistically significant effect on microbiome composition, the correlation between subjects is statistically significant, and treatment has a significant effect on the microbiome composition only in infected subjects who remained infected

Epidemiology of Plasmodium infections in Flores Island, Indonesia using real-time PCR

BACKGROUND:\ud DNA-based diagnostic methods have been shown to be highly sensitive and specific for the detection of malaria. An 18S-rRNA-based, real-time polymerase chain reaction (PCR) was used to determine the prevalence and intensity of Plasmodium infections on Flores Island, Indonesia.\ud METHODS:\ud Microscopy and real-time multiplex PCR for the detection of Plasmodium species was performed on blood samples collected in a population-based study in Nangapanda Flores Island, Indonesia.\ud RESULTS:\ud A total 1,509 blood samples were analysed. Real-time PCR revealed prevalence for Plasmodium falciparum, Plasmodium vivax, and Plasmodium malariae to be 14.5%, 13.2%, and 1.9% respectively. Sub-microscopic parasitaemia were found in more than 80% of all positive cases. The prevalence of P. falciparum and P. vivax was significantly higher in subjects younger than 20 years (p <= 0.01). In the present study, among non-symptomatic healthy individuals, anaemia was strongly correlated with the prevalence and load of P. falciparum infections (p <= 0.01; p = 0.02) and with the load of P. vivax infections (p = 0.01) as detected with real-time PCR. Subjects with AB blood group tend to have a higher risk of being infected with P. falciparum and P. vivax when compared to other blood groups.\ud CONCLUSION:\ud The present study has shown that real-time PCR provides more insight in the epidemiology of Plasmodium infections and can be used as a monitoring tool in the battle against malaria. The unsurpassed sensitivity of real-time PCR reveals that sub microscopic infections are common in this area, which are likely to play an important role in transmission and control.Trial registration: Trials number ISRCTN83830814

The Effect of Gut Microbiome Composition on Human Immune Responses: An Exploration of Interference by Helminth Infections

Background: Soil-transmitted helminths have been shown to have the immune regulatory capacity, which they use to enhance their long term survival within their host. As these parasites reside in the gastrointestinal tract, they might modulate the immune system through altering the gut bacterial composition. Although the relationships between helminth infections or the microbiome with the immune system have been studied separately, their combined interactions are largely unknown. In this study we aim to analyze the relationship between bacterial communities with cytokine response in the presence or absence of helminth infections. Results: For 66 subjects from a randomized placebo-controlled trial, stool and blood samples were available at both baseline and 21 months after starting three-monthly albendazole treatment. The stool samples were used to identify the helminth infection status and fecal microbiota composition, while whole blood samples were cultured to obtain cytokine responses to innate and adaptive stimuli. When subjects were free of helminth infection (helminth-negative), increasing proportions of Bacteroidetes was associated with lower levels of IL-10 response to LPS {estimate [95% confidence interval (CI)] −1.96 (−3.05, −0.87)}. This association was significantly diminished when subjects were helminth-infected (helminth positive) (p-value for the difference between helminth-negative versus helminth-positive was 0.002). Higher diversity was associated with greater IFN-γ responses to PHA in helminth-negative (0.95 (0.15, 1.75); versus helminth-positive [−0.07 (−0.88, 0.73), p-value = 0.056] subjects. Albendazole treatment showed no direct effect in the association between bacterial proportion and cytokine responses, although the Bacteroidetes’ effect on IL-10 responses to LPS tended downward in the albendazole-treated group [−1.74 (−4.08, 0.59)] versus placebo [−0.11 (−0.84, 0.62); p-value = 0.193]. Conclusion: We observed differences in the relationship between gut microbiome composition and immune responses, when comparing individuals infected or uninfected with geohelminths. Although these findings are part of a preliminary exploration, the data support the hypothesis that intestinal helminths may modulate immune responses, in unison with the gut microbiota. Trial Registration: ISRCTN, ISRCTN83830814. Registered 27 February 2008 — Retrospectively registered, http://www.isrctn.com/ISRCTN83830814

Assay strategies for the discovery and validation of therapeutics targeting <i>Brugia pahangi</i> Hsp90

The chemotherapy of lymphatic filariasis relies upon drugs such as diethylcarbamazine and ivermectin that largely target the microfilarial stages of the parasite, necessitating continued treatment over the long reproductive life span of the adult worm. The identification of compounds that target adult worms has been a long-term goal of WHO. Here we describe a fluorescence polarization assay for the identification of compounds that target Hsp90 in adult filarial worms. The assay was originally developed to identify inhibitors of Hsp90 in tumor cells, and relies upon the ability of small molecules to inhibit the binding of fluorescently labelled geldanamycin to Hsp90. We demonstrate that the assay works well with soluble extracts of Brugia, while extracts of the free-living nematode C. elegans fail to bind the probe, in agreement with data from other experiments. The assay was validated using known inhibitors of Hsp90 that compete with geldanamycin for binding to Hsp90, including members of the synthetic purine-scaffold series of compounds. The efficacy of some of these compounds against adult worms was confirmed in vitro. Moreover, the assay is sufficiently sensitive to differentiate between binding of purine-scaffold compounds to human and Brugia Hsp90. The assay is suitable for high-throughput screening and provides the first example of a format with the potential to identify novel inhibitors of Hsp90 in filarial worms and in other parasitic species where Hsp90 may be a target