Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5’CACACGGTTGTATGTCGGTTTCGCT3’ and oligo 2: 5’TCAAGGAGCTCAATGTTAC GCT3’. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia

A Field Study Using the Polymerase Chain Reaction (Pcr) to Screen for Brugia Microfilariae in Human and Animal Blood

Blood samples from 43 humans and 14 cats positive with Brugia microfilariae were analyzed in a field study in Tanjung Pinang, Indonesia. The study used the polymerase chain reaction (PCR) to compare the sensitivity of radioactive and biotinylated species-specific oligonuleotide probes. The cloning char­acterization of the Hha I repeat DNA family found in filarial parasites of the genus Brugia, and the development of species-specific probes for B.malayi and B.pahangi based on these repeats has been described elsewhere (PNAS USA 83: 797-801); Mol.Biochem. Parasitol. 2$: 163-170). The use of radioisotopes for labelling DNA probes is both expensive and inconvenient. To replace these probes, biotinylated DNA probes have been designed for non- radioactive detection of B.malayi and B.pahangi. These oligonucleotide probes have long tails of biotinylated uridine residues added to their 5\u27 end. As little as 100 pg of Brugia DNA can be detected on dot blot with these probes. Detection of the probes is based on an avidin-alkaline phosphatase colorimetric assay. In order to distinguish between infected from uninfected individuals, it is necessary to detect the amount of DNA in one microfilaria (about 60 pg). The polymerase chain reaction (PCR) is a procedure in which a small amount of DNA can be amplified up to 1 million-fold. A part of each sample in this study was PCR amplified and compared with the unamplified portion using both the radioactive and biotinylated DNA probe. The PCR amplified samples were accurately identified by both the radioactive and biotinylated B.malayi and B.pahangi probes. Even samples with as few as two microfilariae per lOOul of blood were easily detected. The samples that were not PCR amplified were accurately identified after only long exposures (greater than one week) to the radioactive probes. The biotinylated probes, were not sensitive enough for accurate identification of the non-PCR amplified samples. The polymerase chain reaction is, therefore, a promising new tool for enhancing the sensitivity of parasite detection assays based on DNA probes. This will be especially important in designing assay based on non-radioactive DNA probes

Multicentre evaluations of two new rapid IgG4 tests (WB rapid and panLF rapid) for detection of lymphatic filariasis

In the global effort to eliminate lymphatic filariasis (LF), rapid field-applicable tests are useful tools that will allow on-site testing to be performed in remote places and the results to be obtained rapidly. Exclusive reliance on the few existing tests may jeopardize the progress of the LF elimination program, thus the introduction of other rapid tests would be useful to address this issue. Two new rapid immunochromatographic IgG4 cassette tests have been produced, namely WB rapid and panLF rapid, for detection of bancroftian filariasis and all three species of lymphatic filaria respectively. WB rapid was developed using BmSXP recombinant antigen, while PanLF rapid was developed using BmR1 and BmSXP recombinant antigens. A total of 165 WB rapid and 276 panLF rapid tests respectively were evaluated at USM and the rest were couriered to another university in Malaysia (98 WB rapid, 129 panLF rapid) and to universities in Indonesia (56 WB rapid, 62 panLF rapid), Japan (152 of each test) and India (18 of each test) where each of the tests underwent independent evaluations in a blinded manner. The average sensitivities of WB rapid and panLF rapid were found to be 97.6% (94%–100%) and 96.5% (94%–100%) respectively; while their average specificities were both 99.6% (99%–100%). Thus this study demonstrated that both the IgG4 rapid tests were highly sensitive and specific, and would be useful additional tests to facilitate the global drive to eliminate this disease

Epidemiology of Plasmodium infections in Flores Island, Indonesia using real-time PCR

BACKGROUND:\ud DNA-based diagnostic methods have been shown to be highly sensitive and specific for the detection of malaria. An 18S-rRNA-based, real-time polymerase chain reaction (PCR) was used to determine the prevalence and intensity of Plasmodium infections on Flores Island, Indonesia.\ud METHODS:\ud Microscopy and real-time multiplex PCR for the detection of Plasmodium species was performed on blood samples collected in a population-based study in Nangapanda Flores Island, Indonesia.\ud RESULTS:\ud A total 1,509 blood samples were analysed. Real-time PCR revealed prevalence for Plasmodium falciparum, Plasmodium vivax, and Plasmodium malariae to be 14.5%, 13.2%, and 1.9% respectively. Sub-microscopic parasitaemia were found in more than 80% of all positive cases. The prevalence of P. falciparum and P. vivax was significantly higher in subjects younger than 20 years (p <= 0.01). In the present study, among non-symptomatic healthy individuals, anaemia was strongly correlated with the prevalence and load of P. falciparum infections (p <= 0.01; p = 0.02) and with the load of P. vivax infections (p = 0.01) as detected with real-time PCR. Subjects with AB blood group tend to have a higher risk of being infected with P. falciparum and P. vivax when compared to other blood groups.\ud CONCLUSION:\ud The present study has shown that real-time PCR provides more insight in the epidemiology of Plasmodium infections and can be used as a monitoring tool in the battle against malaria. The unsurpassed sensitivity of real-time PCR reveals that sub microscopic infections are common in this area, which are likely to play an important role in transmission and control.Trial registration: Trials number ISRCTN83830814

Mass deworming for improving health and cognition of children in endemic helminth areas: A systematic review and individual participant data network meta‐analysis

Background: Soil transmitted (or intestinal) helminths and schistosomes affect millions of children worldwide. Objectives: To use individual participant data network meta-analysis (NMA) to explore the effects of different types and frequency of deworming drugs on anaemia, cognition and growth across potential effect modifiers. Search Methods: We developed a search strategy with an information scientist to search MEDLINE, CINAHL, LILACS, Embase, the Cochrane Library, Econlit, Internet Documents in Economics Access Service (IDEAS), Public Affairs Information Service (PAIS), Social Services Abstracts, Global Health CABI and CAB Abstracts up to March 27, 2018. We also searched grey literature, websites, contacted authors and screened references of relevant systematic reviews. Selection Criteria: We included randomised and quasirandomised deworming trials in children for deworming compared to placebo or other interventions with data on baseline infection. Data Collection and Analysis: We conducted NMA with individual participant data (IPD), using a frequentist approach for random-effects NMA. The covariates were: age, sex, weight, height, haemoglobin and infection intensity. The effect estimate chosen was the mean difference for the continuous outcome of interest. Results: We received data from 19 randomized controlled trials with 31,945 participants. Overall risk of bias was low. There were no statistically significant subgroup effects across any of the potential effect modifiers. However, analyses showed that there may be greater effects on weight for moderate to heavily infected children (very low certainty evidence). Authors' Conclusions: This analysis reinforces the case against mass deworming at a population-level, finding little effect on nutritional status or cognition. However, children with heavier intensity infections may benefit more. We urge the global community to adopt calls to make data available in open repositories to facilitate IPD analyses such as this, which aim to assess effects for the most vulnerable individuals

Regulatory T Cells in Human Lymphatic Filariasis: Stronger Functional Activity in Microfilaremics

Infection with filarial parasites is associated with T cell hyporesponsiveness, which is thought to be partly mediated by their ability to induce regulatory T cells (Tregs) during human infections. This study investigates the functional capacity of Tregs from different groups of filarial patients to suppress filaria-specific immune responses during human filariasis. Microfilaremic (MF), chronic pathology (CP) and uninfected endemic normal (EN) individuals were selected in an area endemic for Brugia timori in Flores island, Indonesia. PBMC were isolated, CD4CD25hi cells were magnetically depleted and in vitro cytokine production and proliferation in response to B. malayi adult worm antigen (BmA) were determined in total and Treg-depleted PBMC. In MF subjects BmA-specific T and B lymphocyte proliferation as well as IFN-gamma, IL-13 and IL-17 responses were lower compared to EN and CP groups. Depletion of Tregs restored T cell as well as B cell proliferation in MF-positives, while proliferative responses in the other groups were not enhanced. BmA-induced IL-13 production was increased after Treg removal in MF-positives only. Thus, filaria-associated Tregs were demonstrated to be functional in suppressing proliferation and possibly Th2 cytokine responses to BmA. These suppressive effects were only observed in the MF group and not in EN or CP. These findings may be important when considering strategies for filarial treatment and the targeted prevention of filaria-induced lymphedema

The development of TH2 responses from infancy to 4 years of age and atopic sensitization in areas endemic for helminth infections

BACKGROUND: Helminth infections and allergies are associated with TH(2) responses. Whereas the development of TH(2) responses and allergic disorders in pediatric populations has been examined in affluent countries, no or little data exist from low income regions of the world. The aim of this study is to examine factors influencing the development of TH(2) responses of children born in areas endemic for helminth infections and to relate these factors to atopic sensitization at 4 years of age. METHODS: Data were collected from pregnant mothers on helminth infections, education and socioeconomic status (SES). Total IgE, IL-5 in response to mitogen, and helminth antigens were measured in children at 2, 5, 12, 24 and 48 months of age. Skin prick testing (SPT) and allergen-specific IgE were determined at 4 years of age. RESULTS: Strong TH(2) responses were seen at 5 months of age and increased with time. Although maternal filarial infection was associated with helminth-antigen specific TH(2) responses, it was low maternal education or SES but not helminth infection, which was associated with the development of high total IgE and PHA-induced IL-5. At 4 years of age when allergen reactivity was assessed by SPT, the high general TH(2) responses did not translate into higher prevalence of SPT. The risk factor for SPT reactivity was low maternal education which decreased the risk of SPT positivity to allergens (adjusted OR, 0.32; 95% CI, 0.12 – 0.87) independently of maternal filarial infection which tended to reduce the child’s risk for being SPT positive (adjusted OR, 0.35; 95% CI, 0.07 – 1.70). CONCLUSIONS: In areas endemic for helminths, potent TH(2) responses were seen early in life, but did not translate into a higher SPT reactivity to allergens. Therefore, in many parts of the world TH(2) responses in general and IgE in particular cannot be used for diagnosis of allergic diseases

Mass deworming for improving health and cognition of children in endemic helminth areas: A systematic review and individual participant data network meta‐analysis

BackgroundSoil transmitted (or intestinal) helminths and schistosomes affect millions of children worldwide.ObjectivesTo use individual participant data network meta‐analysis (NMA) to explore the effects of different types and frequency of deworming drugs on anaemia, cognition and growth across potential effect modifiers.Search MethodsWe developed a search strategy with an information scientist to search MEDLINE, CINAHL, LILACS, Embase, the Cochrane Library, Econlit, Internet Documents in Economics Access Service (IDEAS), Public Affairs Information Service (PAIS), Social Services Abstracts, Global Health CABI and CAB Abstracts up to March 27, 2018. We also searched grey literature, websites, contacted authors and screened references of relevant systematic reviews.Selection CriteriaWe included randomised and quasirandomised deworming trials in children for deworming compared to placebo or other interventions with data on baseline infection.Data Collection and AnalysisWe conducted NMA with individual participant data (IPD), using a frequentist approach for random‐effects NMA. The covariates were: age, sex, weight, height, haemoglobin and infection intensity. The effect estimate chosen was the mean difference for the continuous outcome of interest.ResultsWe received data from 19 randomized controlled trials with 31,945 participants. Overall risk of bias was low. There were no statistically significant subgroup effects across any of the potential effect modifiers. However, analyses showed that there may be greater effects on weight for moderate to heavily infected children (very low certainty evidence).Authors' ConclusionsThis analysis reinforces the case against mass deworming at a population‐level, finding little effect on nutritional status or cognition. However, children with heavier intensity infections may benefit more. We urge the global community to adopt calls to make data available in open repositories to facilitate IPD analyses such as this, which aim to assess effects for the most vulnerable individuals.</div

Dynamic changes in human-gut microbiome in relation to a placebo-controlled anthelminthic trial in Indonesia

Background: Microbiome studies suggest the presence of an interaction between the human gut microbiome and soil-transmitted helminth. Upon deworming, a complex interaction between the anthelminthic drug, helminths and microbiome composition might occur. To dissect this, we analyse the changes that take place in the gut bacteria profiles in samples from a double blind placebo controlled trial conducted in an area endemic for soil transmitted helminths in Indonesia. Methods: Either placebo or albendazole were given every three months for a period of one and a half years. Helminth infection was assessed before and at 3 months after the last treatment round. In 150 subjects, the bacteria were profiled using the 454 pyrosequencing. Statistical analysis was performed cross-sectionally at pre-treatment to assess the effect of infection, and at post-treatment to determine the effect of infection and treatment on microbiome composition using the Dirichlet-multinomial regression model. Results: At a phylum level, at pre-treatment, no difference was seen in microbiome composition in terms of relative abundance between helminth-infected and uninfected subjects and at post-treatment, no differences were found in microbiome composition between albendazole and placebo group. However, in subjects who remained infected, there was a significant difference in the microbiome composition of those who had received albendazole and placebo. This difference was largely attributed to alteration of Bacteroidetes. Albendazole was more effective against Ascaris lumbricoides and hookworms but not against Trichuris trichiura, thus in those who remained infected after receiving albendazole, the helminth composition was dominated by T. trichiura. Discussion: We found that overall, albendazole does not affect the microbiome composition. However, there is an interaction between treatment and helminths as in subjects who received albendazole and remained infected there was a significant alteration in Bacteroidetes. This helminth-albendazole interaction needs to be studied further to fully grasp the complexity of the effect of deworming on the microbiome. Trial registration: ISRCTN Registy, ISRCTN83830814