PCR-RFLP Using BseDI Enzyme for Pork Authentication in Sausage and Nugget Products

A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using BseDI restriction enzyme had been applied for identifying the presence of pork in processed meat (beef sausage and chicken nugget) including before and after frying. Pork sample in various levels (1%, 3%, 5%, 10%, and 25 %) was prepared in a mixture with beef and chicken meats and processed for sausage and nugget. The primers CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b (cyt b) gene and PCR successfully amplified fragments of 359 bp. To distinguish existence of porcine species, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed pig mitochondrial DNA was cut into 131 and 228 bp fragments. The PCR-RFLP species identification assay yielded excellent results for identification of porcine species. It is a potentially reliable technique for pork detection in animal food processed products for Halal authentication

Pemanfaatan Tumbuhan Famili Fabaceae untuk Pengobatan Penyakit Liver oleh Pengobat Tradisional Berbagai Etnis di Indonesia

Abstract Liver disease is one of the leading causes of death globally. Recently, its prevalence and mortality rate continue to increase. It was reported that Indonesia’s hepatitis prevalence was 1.2% in 2013. Indonesia is the world second largest megabiodiversity country and inhabited by 1,068 ethnicities. Both are assets to explore medicinal plants as well as local knowledge to overcome various diseases. Ethnomedicine research by the National Institute of Health Research and Development (NIHRD) of Republic of Indonesia in year of 2012, 2015, and 2017 resulted in local etnopharmacology and medicinal plants in Indonesia. One important information is data on the use of medicinal plants for the treatment of liver disease by traditional healers from various ethnic groups in Indonesia. Analysis of the information set shows that the most widely used plant species for the treatment of liver disease by battra are included in Fabaceae family. Therefore, further studies of the literature regarding the use of empirical, compound content, therapeutic activities and pharmacology of plant species are used as support or even correction for their use in the treatment of liver disease. Various properties as antibiotics (against viruses, bacteria, parasites, fungi), anti-inflammation, antioxidants, hepatoprotectors, and immunomodulators support the use of these species for the treatment of liver disease. Further research is needed to provide basic data on its use in traditional medicine, obtain and develop new drug compounds, and reveal broader use, not to mention toxic and anti-nutritional compounds. This information is expected to be useful for those who are involved in the ethnobotany, botany, pharmacognosy, and pharmacology fields. Abstrak Penyakit liver termasuk salah satu penyakit yang menjadi penyebab kematian utama secara global, dengan angka kematian terus mengalami peningkatan. Hepatitis merupakan salah satu penyakit liver, prevalensi di Indonesia pada tahun 2013 mencapai 1,2%. Sebagai negara megabiodiversitas nomor dua di dunia yang dihuni oleh 1.068 etnis/suku bangsa, Indonesia kaya akan tumbuhan yang dapat dimanfaatkan untuk mengatasi berbagai penyakit. Riset etnomedisin oleh Badan Litbang Kesehatan RI pada tahun 2012, 2015, dan 2017 menghasilkan metadata pengetahuan lokal etnofarmakologi dan tumbuhan obat Indonesia. Salah satu informasi pentingnya yaitu data pemanfaatan tumbuhan obat untuk pengobatan penyakit liver oleh pengobat tradisional (battra) dari berbagai etnis di Indonesia. Analisis terhadap set informasi tersebut menunjukkan bahwa spesies tumbuhan paling banyak digunakan untuk pengobatan penyakit liver termasuk dalam famili Fabaceae. Oleh karena itu, dilakukan studi literatur mengenai pemanfaatan empiris, kandungan senyawa, aktivitas terapeutik dan farmakologi spesies-spesies tumbuhan tersebut sebagai dukungan atau bahkan koreksi terhadap pemanfaatannya untuk pengobatan penyakit liver. Berbagai khasiat sebagai antibiotik (terhadap virus, bakteri, parasit, jamur), anti-inflamasi, antioksidan, hepatoprotektor, dan imunomodulator menyokong pemanfaatan spesies tersebut untuk pengobatan penyakit liver. Penelitian lebih lanjut sangat diperlukan untuk memberikan data dasar penggunaannya dalam pengobatan tradisional, mendapat dan mengembangkan senyawa obat baru, serta mengungkap pemanfaatan yang lebih luas tak terkecuali pula terhadap senyawa toksik dan anti-nutrisi. Informasi ini diharapkan dapat bermanfaat bagi yang menggeluti bidang etnobotani, botani, farmakognosi, dan farmakologi

Pengaruh suhu terhadap infeksi camv pada brassica rapa menggunakan metode agroinfeksi

ABSTRAK Penggutzaan Cauliflower mosaic virus (CaMV) sebagai penanda dalatn agroinfeksi merupakan metode peka untuk mempelajari proses pemindahan DNA dari Agrobacteritnn tumefacien ke sel tanaman. Metode ini selanjutnya diharapkan, dapat dipakai dalam mempelajari proses penghambatan pembentukan tumor, yang dalan hal ini kemungkinan terjadi pada proses pemindahan DNA ke tanaman. Seperti diketahui bahwa pembentukan tumor merupakan basil dari serangkaian proses, yang ketnungldnan salah satu dari proses tersebut adalah peka terhadap panas. Untuk itu terlebih dahulu perlu dipelajari sejauh mana ketahanan CaMV terhadap panas. Informasi ini sangat diperlukan guna menentukan baik tidaknya penanda tersebut digunakan. Pada penelitian ini A.tumefacien pembawa diner CaMV yang diklon pada bagian tengah T-DNA (pGV3850414D), pada sebelah kiri dari 1-DNA (pHind10414D) dan pada bagian kromosom baicteri (pC5806414D) serta plasmid galur alam pTiC58 digunakan untuk menginokulasi Brassica rapa pada berbagai suhu, antara 26°C sampai 37°C. Hasil inokulasi dievaluasi berdasarkan pada terjadinya tanda infeksi, timbulnya tumor dan hibridisasi dot blot. Hasid penelitian tnenunjukkan bahwa kenaikkan suhu menyebabkan penurunan frekuensi terjadinya infeksi virus maupun terbentuknya tumor sampai aldu\u27rnya dihantbat sama sekali, yaitu pada teï´peratur 35°C untuk infeksi CaMV dan 37°C untuk pembentukan tumor. Kata kund : CaMV, Agroinfeksi ABSTRACT The use of the induction of virus symptoms of Cauliflower mosaic virus (CaMV) as a marker, Agroinfection, is a sensitive way of investigating transfer of DNA from Agrobacterium tumefacien to plant cell. This method was then planned to be used to acces whether a thermosensitive step was involved in the process of transfer, as known that the process of tumour formation is a result from a number of processes any of which might be thermosensitive. For this experiment, firstly investigation of thermal inhibition of virus symptom was required as to find out whether CaMV was useful as a marker. During this experiment Agrobacterium tumefacien containing dinners of CaMV DNA which was cloned within T-DNA (pGV3850414D), on the left side of T-DNA (pillind10414D), within the bacterial chromosome (pC58065414D) and the wild type of A.turnefacien (pTiC58) were used to infect Brassica rapa (turnip). The result was then evaluate based on the viral symptom, tumor formation and dot blot hybridisation. The result indicated that temperature was involved in the viral symptom and tumou

Simultaneous detection of pork and wild boar meat in chicken sausages using the combination of a single primer and real-time polymerase chain reaction (qPCR)

The identification of meat species in food products and pharmaceuticals is vital to minimize food adulteration practices. Due to its specificity, polymerase chain reaction (PCR)-based methods are the most commonly reported methods for detection of food adulterants. This study was aimed to evaluate the use of real-time PCR with a species-specific primer to identify two non-halal types of meat, namely pork and wild boar meat (WBM), in chicken sausages. The primer was designed using online software PrimerQuest from NCBI (National Center for Biotechnology Information) to target the mitochondrial ND1 gene of Sus scrofa domestica. The annealing temperature (Ta) of the primer used during real-time PCR analysis was optimized to achieve the highest response fluorescence unit at the lowest cycles. Real-time PCR using the primers of NK-ND1-Ssc1 (Forward: 5’ AAAGGACCCAACGTTGTAGG 3’ and Reverse: 5’ TAGTGCTAGGGATAAGGCTAGG 3’) was validated with several parameters, namely specificity, the limit of detection for sensitivity, linearity, efficiency, and repeatability. The optimum annealing temperature of NK-ND1-Ssc1 was 58.1oC. The sensitivity evaluation revealed that the limits of detection (LoD) of pork and WBM in reference sausage samples containing 100% pork and WBM were 500 pg and 50 pg, respectively, which correspond to 0.3% meat in sausage products. The efficiency values of real-time PCR amplification were 93.1% and 94.8% for pork and WBM with coefficient variations of 0.2884% and 0.4998%, respectively. The validated method was subsequently applied to analyze the commercial samples, and among the twelve (12) samples evaluated, there was one sample positive of containing non-halal meat (pork or WBM). Real-time PCR using species-specific primers, e.g., NK-ND1-Ssc1, is specific and sensitive; therefore, this method can be used as an alternative technique for authentication of halal meat

Cytotoxic effects of methanol extract isolated from Erythrina fusca Lour leaves on cancer cell-lines

ABSTRACT Sismindari - Cytotoxic effects of methanol extract isolated from Erythrina fusca Lour on cancer cell-lines Background: Erythrina is a medicinal plant which is frequently used to treat cancer in Africa. People in Java, however, use Erythrina fusca (cangkring) to treat varicella and measles. Previous works demonstrated that the methanol extract of this plant\u27s leaves induced DNA topoisomerase II mediated DNA cleavage. This activity has been used widely as a target to find anticancer medicine. In order to be scientifically proofed the activity, therefore, it is necessary to analyze directly on the cancer cell-lines. Objectives: To identify the cytotoxicity effect of methanol extract of E. fusca leaves against cancer cell-lines. Methods: Cytotoxicity analysis of methanol extract isolated from E. fusca leaves was carried out against myeloma and HeLa S-3 cancer cell-lines, and to normal mononuclear cell. The level of cytotoxicity was determined by calculating the level of IC50 which was based on the percentage of the cell death following the 24 hours incubation with the extract. Results: It was demonstrated that this methanol extract was cytotoxic to myeloma and HeLa S-3 cell-lines with the IC50 of 0.005 mg/ml and IC50 of 0.08 mg/ml respectively. The percentage of the cell death on treated normal mononuclear cell with the extract, however, was very much low 110%). This was similar to that on the DMSO treated cells. Conclusion: The methanol extract isolated from E. fusca leaves was demonstrated had a selective cytotoxicity effect, as indicated by the level of the IC50 which was higher to myeloma compared to HeLa S3 cell-line, and had much less cytotoxic on normal mononuclear cells. Key words: Erythrina fusca, cytotoxicity, cancer cell-lines, mononuclear cel

VALIDASI METODE ANALISA PENETAPAN KADAR EPIGALOKATEKIN GALAT DENGAN KLT DENSITOMETRI

TLC Densitometry is one of method which was used to measure amount of activesubstance. Active substance of epigallocathechin gallate is one of in green tea extractcream. Method of analysis must be validated to prove that method will give the dataclose with the real value. Aim of this research is to prove that TLC Densitometry methodhave liniearity, precision and accuration that fulfill the requirement. This study usedconcentration 600, 1800 and 3000 ug/ml with 3 replications to measure precision(based on value of CV) and accuration (based on value of recovery). Liniearity wasknown based on value of r of curve regression between concentration and wide area ofchromatogram. LOD and LOQ was calculated based on curve regression. Researchshowed that method of analyse had liniearity with r= 0,98. Value of CV concentrationof 600, 1800 and 3000 ug/ml were 8,18%; 3,19% and 1,53%, respectively and recoverywere 88,10%; 99,65% dan 111,33%, respectively. Value of LOD was 827,01 µg/ml andLOQ was 2756,69 µg/ml

Antiproliferative Effect and Apoptosis Induced in Human Cell Lines by Bruguiera gymnorhiza Barks Methanol Extract

The Antiproliferative effects of methanol extract from Bruguiera gymnorhiza (B. gymnorhiza) barks were tested in vitro against three human cell lines: Hela, Raji and Myeloma cells. The extract was found to have antiproliferative effects against Hela, Raji and Myeloma cells with an IC50 value of 133, 504 and 384 µg/mL, respectively. The antiproliferative test was then performed on Hela, Raji, and Myeloma cells. Cytotoxicity assay of the extract was then determined using MTT method. There were some indications of apoptosis, such DNA fragmentation, as assessed by acrydine orange- ethidium bromide staining. These results indicate that extract from B. gymnorhiza barks can induce apoptosis in human cell lines.Keywords: Antiproliferative, Apoptosis, B. gymnorhiz

VALIDASI METODE ANALISA PENETAPAN KADAR EPIGALOKATEKIN GALAT DENGAN KROMATOGRAFI CAIR KINERJA TINGGI

High Performance Liquid Chromatography (HPLC) was one of analytical methodscommonly used to determine the concentration of epigallocatechin gallate (EGCG) on green teaextract. The method must be validated in order to fit to its purpose. The aim of this research was toprove that the used method has selectifity, liniearity, precise, accurate and know limit of detection(LOD) and limit of quantification (LOQ) is acceptable. The selectivity of analytical method wasdetermined by calculating the resolution value between two peak. Data from 10 μg/mL and100 μg/mL with 5 replicates would give precition and accuration. Precition was known from CV value and accuration was known from recovery value in each concentration. Liniearity was knownfrom regression linear between concentration and wide area of peak. From regresion linear couldcalculate LOD and LOQ. Research show that method of analyse have selectificity withRs= 2.27>1.5; liniearity with r= 0.99; precision with CV 8.74% at concentration 200 µg/mL and3.74% at concentration 500 µg/mL; accuration with recovery 99.76% at concentration 200 µg/mLand 100.52% at concentration 500 µg/mL and the value of LOD is 33.28 μg/mL and LOQ is110.93 μg/mL

PROTECTIVE EFFECT ETHANOLIC EXTRACT OF Boesenbergia pandurata (ROXB.) Schlecht. AGAINST UVB-INDUCED DNA DAMAGES IN BALB/C MICE

Boesenbergia pandurata (Roxb.) Schlecht. contains bioactive compounds that have a number healthy effect including anti-oxidant and anti-carcinogenic activity. This research was carried out to examine the protective effect of B. pandurata extract against expression of cyclobutane pyrimidine dimers (CPDs) as marker of UVB-induced DNA damage in Balb/c mice. Dried powder of B. pandurata rhizomes was extracted by maceration method using 96% ethanol. The extract was quantified with pinostrobin as active marker using TLC scanner. Ethanolic extract of B. pandurata (EEBP) was given orally at 14 days before UV exposure with a variety doses, 0 (vehicle), 20, 40 and 60mg/kgBW/day and continuing until termination of the experiment. Following the UVB irradiation (1.4J/m2), mice were sacrificed at different time points (2, 24, 48, and 72h after UVB exposure). The back skin samples were collected to analyze CPDs expression by immunohistochemical method. The result showed that EEBP (contained 5% pinostrobin) dose was 40 and 60mg/kgBW/day had protective activity against UV-induced DNA damage as indicated by the decrease of CPDs expression.   Key words:  Boesenbergia pandurata (Roxb.) Schlecht., UVB, DNA damage, CPDs

Antiproliferatif Ekstrak Metanol Daun Dianella nemorosa Lam. (Liliaceae) terhadap Sel Kanker MKN45 dengan Menggunakan Metode WST-1

Dianella nemorosa Lam. was known containing alkaloids, terpenoid, phenolic compouds and tanin. Antiproliferative effect of D. nemorosa leaves methanol exctract, which demonstrated to have an in vitro cytotoxic effect on cancer cell line. The aim of research was examined the effect antiproliferative methanol extract of D. nemorosa leaves against MKN45 (gastric cancer) cell line. Leaves powder extracted using methanol. Antiproliferative effect was determined by Cell Proliferation Reagents WST-1 ((2-(4-iodophenyl)-3-(4-nitro-phenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium monosodium salt). Test for 1h, 2h, and 4h after incubated for 72h was done. The result of this research showed that methanol exctract from D. nemorosa possessed remarkable no had antiproliferative activity against MKN45 cell line. The result indicated methanol extract of D. nemorosa leaves selective inhibitory effect or antiproliferative against cell line. Key words: Dianella nemorosa, Antiproliferative, MKN 45, and WST-