971 research outputs found
Fluctuations and Movement Patterns of Race Chicken Egg Prices in Bengkulu Province
Chicken eggs are a staple food with a high enough animal protein content, but the price is quite affordable for all levels of society. This causes the consumption of chicken eggs to be relatively high compared to other animal protein sources, but currently, the amount of production and consumption by the public is not comparable; besides that, the price offered is constantly fluctuating. This study aims to determine price fluctuations and price movement patterns of broiler chicken eggs in Bengkulu Province. The data used is secondary data. The research method uses quantitative descriptive analysis. The research results show that. The risk of fluctuations in the price of broiler eggs in Bengkulu Province has a slightly higher risk for prices at the producer level when compared to prices at the consumer level. The development pattern of broiler egg prices in Bengkulu Province generally shows a positive direction. Fluctuations in the price of broiler eggs occur in specific periods. These fluctuations occur because they coincide with religious holidays such as Ramadan, Eid al-Fitr, Christmas and New Year, the influence of the Russia-Ukraine war, and economic problems due to the Covid-19 pandemic.Telur ayam merupakan salah satu makanan pokok yang memiliki kandungan protein hewani yang cukup tinggi namun harganya cukup terjangkau oleh semua lapisan masyarakat. Hal ini menyebabkan konsumsi telur ayam cukup tinggi dibandingkan sumber protein hewani lainnya, namun saat ini jumlah produksi dan konsumsi masyarakat tidak sebanding, selain itu harga yang ditawarkan selalu berfluktuasi. Penelitian ini bertujuan untuk mengetahui fluktuasi harga dan pola pergerakan harga telur ayam broiler di Provinsi Bengkulu. Data yang digunakan adalah data sekunder. Metode penelitian menggunakan analisis deskriptif kuantitatif. Hasil penelitian menunjukkan bahwa. Risiko fluktuasi harga telur ayam ras di Provinsi Bengkulu memiliki risiko harga yang sedikit lebih tinggi di tingkat produsen jika dibandingkan dengan harga di tingkat konsumen. Pola perkembangan harga telur ayam ras di Provinsi Bengkulu secara umum menunjukkan arah yang positif. Fluktuasi harga telur ayam pedaging terjadi pada periode tertentu. Fluktuasi tersebut terjadi karena bertepatan dengan hari besar keagamaan seperti bulan Ramadan, Idul Fitri, Natal dan Tahun Baru, serta pengaruh perang Rusia-Ukraina, serta masalah ekonomi akibat pandemi Covid-19. 
Biochemical composition of three Tunisian silverside (fish) populations caught in open sea, lagoon and island coasts
Fatty acid and amino acid profiles were determined in three silverside populations caught in Tunisian waters Atherina boyeri (open sea), Atherina lagunae (lagoon) and Atherina sp. (island coasts). Saturated fatty acids reached in total lipids 43.54%, 36.96% in marine and 33.64% in insular silverside and A. lagunae, in which eicosapentaenoic acid, docosahexaenoic acid and linoleic acid were the prominent fatty acids. The n-3/n-6 index showed a significant level indicating a tendency to accumulate n-3 fatty acids in A. boyeri and A. lagunae and n-6 fatty acids in Atherina sp. Total amino acid content ranged from 528 to 588 mg/g crude protein, in which, glutamic acid was the most abundant. Methionine had the lowest essential amino acid score in A. boyeri and Atherina sp. (0.73 and 0.71, respectively)while tryptophan had the lowest in A. lagunae (0.07)
Mean-Periodic Functions Associated with the Jacobi-Dunkl Operator on R
2000 Mathematics Subject Classification: 34K99, 44A15, 44A35, 42A75, 42A63Using a convolution structure on the real line associated with the Jacobi-Dunkl differential-difference operator Λα,β given by:
Λα,βf(x) = f'(x) + ((2α + 1) coth x + (2β + 1) tanh x) { ( f(x) − f(−x) ) / 2 }, α ≥ β ≥ −1/2
, we define mean-periodic functions associated with Λα,β. We characterize these functions as an expansion series intervening appropriate
elementary functions expressed in terms of the derivatives of the eigenfunction of Λα,β. Next, we deal with the Pompeiu type problem and convolution equations for this operator
A Generalization of Girod's Bidirectional Decoding Method to Codes with a Finite Deciphering Delay
Girod's encoding method has been introduced in order to efficiently decode from both directions messages encoded by using finite prefix codes. In the present paper, we generalize this method to finite codes with a finite deciphering delay. In particular, we show that our decoding algorithm can be realized by a deterministic finite transducer. We also investigate some properties of the underlying unlabeled graph
In vitro ruminal fermentation, nutritional evaluation and antioxidant activity of some forest shrubs of North West Tunisia for goats
Chemical composition and characteristics of in vitro fermentation were determined for two shrubs (Genista aspalathoides and Rhamnus alaternus) collected from north western Tunisia. The primary and secondary chemical composition was determined and in vitro fermentation parameters were measured in 100 ml glass syringes for 48 hours to determine gas production. There are significant differences in chemical and wall composition for the two shrubs studied (p < 0.05). Rhamnus alaternus is richer in secondary metabolites (59.2 mg GAE / g DM) than Genista aspalathoides and has the highest content of crude protein (CP). Genista aspalathoides had the lowest anti-radical activity since it has the highest levels of secondary metabolites, so it is the most digestible species with the highest value of gas production after 24 hours incubation and released more methane than Rhamnus alaternus.
Keywords: Shrub, Chemical composition, in vitro fermentation, antioxidant activity, methan
Fungitoxicity of some fungicides against to pathogens responsible of olive trees decline in the Chebika’s area in Tunisia
The incidence of the disease seems very important on young trees and tends to bemoderate with the aging of the tree. In fact, olive trees have a shallow root system and arestill vulnerable to pathogens especially the irrigated varieties. Chemical and biological control against Fusarium solani, Fusarium oxysporum, Rhizoctonia solani and Verticillium dahliae have revealed that the application in vitro of Prodazim and of Methyl-thiophanatehave showed a very good efficacy up to 100%. Ridomil and Tachigaren have indicated aregular efficiency, while the two bio-fungicides Fungstop and the compost juice havedemonstrated a low efficiency. The two bio-control agents Trichoderma harzianum and Gliocladium virens have showed a relatively high effectiveness in vitro. In vivo, obtainedresults have revealed that the nature of the product, the doses applied and the condition ofthe olive trees are highly correlated factors. The treatment doesn’t appear to have apositive effect on the beginning of stage 1 and on plots presented a good structured soil.Going beyond this stage, whatever the product and the doses used, the attack isirreversible
Process capability indices and X , R control chart limit adjustments by taking into account measurement system errors
This paper investigates the effects of measurement system variability arising from evaluations of process capabilities. In this work, relationships between true process capability indices, Cp,True and Cpm,True, and their corresponding observed indices, Cp,Obs and Cpm,Obs, are developed depending on the levels of type I and II errors. Moreover, the method for adjusting control chart limits used to monitor the process is proposed based on measurement system variability. An industrial case study is used to highlight the findings of this investigation and to discuss the adjustment levels that should be conducted depending on the values of type I and type II errors
First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia
Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia. Samples of wild grapevines were labeled during the vegetative season and dormant canes from 84 accessions (male and female plants) were collected during winter. All samples were tested by RT-PCR for the presence of GRSPaV using primers RSP-48 (5'- AGCTGGGATTATAAGGGAGGT-3') and RSP-49 (5'- CCAGCCGTTCCACCACTAAT-3') (Lima et al. 2006a) for the amplification of a 331 bp fragment of the coat protein (CP) gene. Results showed that 51% (43/84) of the samples were infected by GRSPaV. In order to confirm the presence of this virus in wild grapevines, two positive samples (VS56 and VS70) were tested by RT-PCR using primers RSP-52 (5'-TGAAGGCTTTAGGGGTTAG-3') and RSP-53 (5'-CTTAACCCAGCCTTGAAAT-3') (Rowhani et al. 2000) to amplify the complete CP. Isolate VS56 was from a male plant in northern Tunisia and isolate VS70 was from a female plant in the northeast of the country. PCR products of these two isolates were cloned and sequenced in both directions. The Tunisian GRSPaV isolates VS56 (LT855232) and VS70 (LT855235) shared 84% nucleotide sequence identity. Isolate VS56 had 85-86% identity with all GRSPaV sequences available in GenBank, whereas VS70 showed 93-99% identities with isolates SK704-A (KX274274) and ORPN12 (FJ943318). To further confirm the presence of GRSPaV in wild grapevines, the same two samples were tested by RT-PCR using primers McK1U (AGGGATTGGCTGTTAGATGTT) and McK1D (CTTCAGGCAACCCCAAAAA) (Nolasco et al. 2000) to amplify a 355 bp fragment of the RNA-dependent RNA polymerase domain. Isolates VS56 (LT906626) and VS70 (LT906636) shared 89% nucleotide sequence identity. Isolate VS56 had 89-94% identity with isolates SK30 (KX274277) and GRSPaV-MG (FR691076) while VS70 showed 94-95% identity with isolates Tannat-Rspav1 (KR528585) and GRSPaV-GG (JQ922417). To our knowledge, this is the first report of GRSPaV in wild grapevines in Tunisia
Screening of fungi implicated in the dieback of olive trees (Olea europea) in Chebika’s area
Several surveys were conducted during spring 2008 in Chebika’s area in Tunisia. Samples were collected from infected plants showed different types of symptoms and they have been the subject of mycological analysis. The morphological identification of fungal colonies isolated from roots, crown and stems of two olive varieties Koroneiki and Chemlali Sfax, revealed the presence of a fungi complex including Fusarium oxysporum, Fusarium solani, Rhizoctonia solani, Verticillium dahliae, Cladosporium fulvum, Alternaria solani, Alternaria tenuis, Bispora punctata. and Cylindrocarpon .sp; Although,those fungi Fusarium oxysporum, Fusarium solani, Rhizoctonia solani and Verticillium dahliae are ubiquitous and the predominant one. Pathogenicity results revealed that the fungi isolated from olive trees exhibited typical symptoms on Koroneiki variety incontrolled conditions
- …