Effect of charging on CdSe/CdS dot-in-rods single-photon emission

The photon statistics of CdSe/CdS dot-in-rods nanocrystals is studied with a method involving post-selection of the photon detection events based on the photoluminescence count rate. We show that flickering between two states needs to be taken into account to interpret the single-photon emission properties. With post-selection we are able to identify two emitting states: the exciton and the charged exciton (trion), characterized by different lifetimes and different second order correlation functions. Measurements of the second order autocorrelation function at zero delay with post- selection shows a degradation of the single photon emission for CdSe/CdS dot-in-rods in a charged state that we explain by deriving the neutral and charged biexciton quantum yields.Comment: 10 pages, 5 figure

The Developmental Role of Agouti in Color Pattern Evolution

Animal color patterns can affect fitness in the wild; however, little is known about the mechanisms that control their formation and subsequent evolution. We took advantage of two locally camouflaged populations of Peromyscus mice to show that the negative regulator of adult pigmentation, Agouti, also plays a key developmental role in color pattern evolution. Genetic and functional analyses showed that ventral-specific embryonic expression of Agouti establishes a prepattern by delaying the terminal differentiation of ventral melanocytes. Moreover, a skin-specific increase in both the level and spatial domain of Agouti expression prevents melanocyte maturation in a regionalized manner, resulting in a novel and adaptive color pattern. Thus, natural selection favors late-acting, tissue-specific changes in embryonic Agouti expression to produce large changes in adult color pattern.Organismic and Evolutionary Biolog

Aggressive Emerging Pathovars of Xanthomonas arboricola Represent Widespread Epidemic Clones Distinct from Poorly Pathogenic Strains, as Revealed by Multilocus Sequence Typing

Deep and comprehensive knowledge of the genetic structure of pathogenic species is the cornerstone on which the design of precise molecular diagnostic tools is built. Xanthomonas arboricola is divided into pathovars, some of which are classified as quarantine organisms in many countries and are responsible for diseases on nut and stone fruit trees that have emerged worldwide. Recent taxonomic studies of the genus Xanthomonas showed that strains isolated from other hosts should be classified in X. arboricola, extending the host range of the species. To investigate the genetic structure of X. arboricola and the genetic relationships between highly pathogenic strains and strains apparently not relevant to plant health, we conducted multilocus sequence analyses on a collection of strains representative of the known diversity of the species. Most of the pathovars were clustered in separate monophyletic groups. The pathovars pruni, corylina, and juglandis, responsible for pandemics in specific hosts, were highly phylogenetically related and clustered in three distinct clonal complexes. In contrast, strains with no or uncertain pathogenicity were represented by numerous unrelated singletons scattered in the phylogenic tree. Depending on the pathovar, intra- and interspecies recombination played contrasting roles in generating nucleotide polymorphism. This work provides a population genetics framework for molecular epidemiological surveys of emerging plant pathogens within X. arboricola. Based on our results, we propose to reclassify three former pathovars of Xanthomonas campestris as X. arboricola pv. arracaciae comb. nov., X. arboricola pv. guizotiae comb. nov., and X. arboricola pv. zantedeschiae comb. nov. An emended description of X. arboricola Vauterin et al. 1995 is provided

Photon correlations for colloidal nanocrystals and their clusters

Images of semiconductor `dot in rods' and their small clusters are studied by measuring the second-order correlation function with a spatially resolving ICCD camera. This measurement allows one to distinguish between a single dot and a cluster and, to a certain extent, to estimate the number of dots in a cluster. A more advanced measurement is proposed, based on higher-order correlations, enabling more accurate determination of the number of dots in a small cluster. Nonclassical features of the light emitted by such a cluster are analyzed.Comment: 4 pages, 4 figure

Formation of Zn–Ca phyllomanganate nanoparticles in grass roots

International audienceIt is now well established that a number of terrestrial and aquatic microorganisms have the capacity to oxidize and precipitate Mn as phyllomanganate. However, this biomineralization has never been shown to occur in plant tissues, nor has the structure of a natural Mn(IV) biooxide been characterized in detail. We show that the graminaceous plant Festuca rubra (red fescue) produces a Zn-rich phyllomanganate with constant Zn:Mn and Ca:Mn atomic ratios (0.46 and 0.38, respectively) when grown on a contaminated sediment. This new phase is so far the Zn-richest manganate known to form in nature (chalcophanite has a Zn:Mn ratio of 0.33) and has no synthetic equivalent. Visual examination of root fragments under a microscope shows black precipitates about ten to several tens of microns in size, and their imaging with backscattered and secondary electrons demonstrates that they are located in the root epidermis. In situ measurements by Mn and Zn K-edge extended X-ray absorption fine structure (EXAFS) spectroscopy and X-ray diffraction (XRD) with a micro-focused beam can be quantitatively described by a single-phase model consisting of Mn(IV) octahedral layers with 22% vacant sites capped with tetrahedral and octahedral Zn in proportions of 3:1. The layer charge deficit is also partly balanced by interlayer Mn and Ca. Diffracting crystallites have a domain radius of 33 Å in the ab plane and contain only 1.2 layers (not, vert, similar8.6 Å) on average. Since this biogenic Mn oxide consists mostly of isolated layers, basal 00l reflections are essentially absent despite its lamellar structure. Individual Mn layers are probably held together in the Mn–Zn precipitates by stabilizing organic molecules. Zinc biomineralization by plants likely is a defense mechanism against toxicity induced by excess concentrations of this metal in the rhizosphere

Comparative Genomics of Pathogenic and Nonpathogenic Strains of Xanthomonas arboricola Unveil Molecular and Evolutionary Events Linked to Pathoadaptation

The bacterial species Xanthomonas arboricola contains plant pathogenic and nonpathogenic strains. It includes the pathogen X. arboricola pv. juglandis, causing the bacterial blight of Juglans regia. The emergence of a new bacterial disease of J, regia in France called vertical oozing canker (VOC) was previously described and the causal agent was identified as a distinct genetic lineage within the pathovar Symptoms on walnut leaves and fruits are similar to those of a bacterial blight but VOC includes also cankers on trunk and branches. In this work, we used comparative genomics and physiological tests to detect differences between four X. arboricola strains isolated from walnut tree: strain CFBP 2528 causing walnut blight (WB), strain CFBP 7179 causing VOC and two nonpathogenic strains, CFBP 7634 and CFBP 7651, isolated from healthy walnut buds. Whole genome sequence comparisons revealed that pathogenic strains possess a larger and wider range of mobile genetic elements than nonpathogenic strains. One pathogenic strain, CFBP 7179, possessed a specific integrative and conjugative element (ICE) of 95 kb encoding genes involved in copper resistance, transport and regulation. The type three effector repertoire was larger in pathogenic strains than in nonpathogenic strains. Moreover, CFBP 7634 strain lacked the type three secretion system encoding genes. The flagellar system appeared incomplete and nonfunctional in the pathogenic strain CFBP 2528. Differential sets of chemoreceptor and different repertoires of genes coding adhesins were identified between pathogenic and nonpathogenic strains. Besides these differences, some strain-specific differences were also observed. Altogether, this study provides valuable insights to highlight the mechanisms involved in ecology, environment perception, plant adhesion and interaction, leading to the emergence of new strains in a dynamic environment

Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer

Development of multilocus variable-number tandem repeat analysis (MLVA) for Xanthomonas arboricola pathovars

Xanthomonas arboricola is an important bacterial species, the pathovars of which are responsible for bacterial blight diseases on stone fruit, hazelnut, Persian walnut, poplar, strawberry, poinsettia and banana. In this study, we evaluated variable number tandem repeats (VNTR) as a molecular typing tool for assessing the genetic diversity within pathovars of X. arboricola. Screening of the X. arboricola pv. pruni genome sequence (CFBP5530 strain) predicted 51 candidate VNTR loci. Primer pairs for polymerase chain reaction (PCR) amplification of all 51 loci were designed, and their discriminatory power was initially evaluated with a core collection of 8 X. arboricola strains representative of the different pathovars. Next, the 26 polymorphic VNTR loci present in all strains were used for genotyping a collection of 61 strains. MLVA is a typing method that clearly differentiates X. arboricola strains. The MLVA scheme described in this study is a rapid and reliable molecular typing tool that can be used for further epidemiological studies of bacterial diseases caused by X. arboricola pathovars

Photon correlations for colloidal nanocrystals and their clusters

Images of semiconductor “dot-in-rods” and their small clusters are studied by measuring the second-order correlation function with a spatially resolving intensified CCD camera. This measurement allows one to distinguish between a single dot and a cluster and, to a certain extent, to estimate the number of dots in a cluster. A more advanced measurement is proposed, based on higher-order correlations, enabling more accurate determination of the number of dots in a small cluster. Nonclassical features of the light emitted by such a cluster are analyzed

Optically Implemented Broadband Blueshift Switch in the Terahertz Regime

Cataloged from PDF version of article.We experimentally demonstrate, for the first time, an optically implemented blueshift tunable metamaterial in the terahertz (THz) regime. The design implies two potential resonance states, and the photoconductive semiconductor (silicon) settled in the critical region plays the role of intermediary for switching the resonator from mode 1 to mode 2. The observed tuning range of the fabricated device is as high as 26% (from 0.76 THz to 0.96 THz) through optical control to silicon. The realization of broadband blueshift tunable metamaterial offers opportunities for achieving switchable metamaterials with simultaneous redshift and blueshift tunability and cascade tunable devices. Our experimental approach is compatible with semiconductor technologies and can be used for other applications in the THz regime