The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

A unified framework based on the binding polynomial for characterizing biological systems by isothermal titration calorimetry

Isothermal titration calorimetry (ITC) has become the gold-standard technique for studying binding processes due to its high precision and sensitivity, as well as its capability for the simultaneous determination of the association equilibrium constant, the binding enthalpy and the binding stoichiometry. The current widespread use of ITC for biological systems has been facilitated by technical advances and the availability of commercial calorimeters. However, the complexity of data analysis for non-standard models is one of the most significant drawbacks in ITC. Many models for studying macromolecular interactions can be found in the literature, but it looks like each biological system requires specific modeling and data analysis approaches. The aim of this article is to solve this lack of unity and provide a unified methodological framework for studying binding interactions by ITC that can be applied to any experimental system. The apparent complexity of this methodology, based on the binding polynomial, is overcome by its easy generalization to complex systems

Magnetoresistivity As A Probe To The Field-induced Change Of Magnetic Entropy In R Al2 Compounds (r=pr,nd,tb,dy,ho,er)

The heat capacity CP (T) of the ferromagnetic compounds R Al2 (R=Pr,Nd,Tb,Dy,Ho,Er) was measured at zero and applied magnetic field of 5 T in the temperature interval from 2 to 200 K. From these results are calculated the magnetic component of the entropy change, -Δ Smag (T) =S (0,T) -S (H,T). From resistivity measurements, ρ (H,T), from 2 to 300 K in the same compounds, we calculated the resistivity change due to the applied magnetic field, -Δ ρmag (T) = [ρmag (0,T) - ρmag (H,T)]. The results are compared and we observed a similar dependence between -Δ ρmag (T) and (T/ TC) m Δ Smag (T) with m=0 for T≥ TC and m=1 for T≤ TC. A simple model using a Hamiltonian considering molecular and crystalline electric fields, in a mean field approximation, is adopted for the calculus. Our results show that theory and experiment are in good agreement showing that the magnetoresistivity is a probe to the field-induced change of magnetic entropy in these compounds and can be extended to other materials. A model for the factor connecting both quantities, -Δ Smag (T) and -Δ ρmag (T), is developed. This factor contains mainly the effective exchange integral which is related to Fermi energy that in turn is related to the electron effective mass. © 2006 The American Physical Society.7413Ziman, M., (1972) Electrons and Phonons, , Oxford University Press, LondonPurwins, H.G., Leson, A., (1990) Adv. Phys., 39, p. 309. , ADPHAH 0001-8732 10.1080/00018739000101511Pecharsky, V.K., Gschneidner Jr., K.A., Pecharsky, A.O., Tishin, A.M., (2001) Phys. Rev. B, 64, p. 144406. , PRBMDO 0163-1829 10.1103/PhysRevB.64.144406Potter, H.H., (1932) Philos. Mag., Suppl., 13, p. 233. , ADPHAH 0001-8732Alexander, S., Helman, J.S., Balberg, I., (1976) Phys. Rev. B, 13, p. 304. , PLRBAQ 0556-2805 10.1103/PhysRevB.13.304Potter, H.H., (1931) Proc. R. Soc. London, Ser. a, 132, p. 560. , PRLAAZ 1364-5021Ravishankar, K., Sablik, M.J., Levy, P.M., Uffer, L.F., (1974) AIP Conf. Proc., 18, p. 923. , APCPCS 0094-243XVan Daal, H.J., Buschow, K.H.J., (1969) Solid State Commun., 7, p. 217. , SSCOA4 0038-1098Inoue, T., Sankar, S.G., Craig, R.S., Wallace, W.E., Gschneidner Jr., K.A., (1977) J. Phys. Chem. Solids, 38, p. 487. , JPCSAW 0022-3697Deenadas, C., Thompson, A.W., Craig, R.S., Wallace, W.E., (1971) J. Phys. Chem. Solids, 32, p. 1853. , JPCSAW 0022-3697Ibarra, M.R., Lee, E.W., Del Moral, A., Moze, O., (1985) Solid State Commun., 53, p. 183. , SSCOA4 0038-1098Ibarra, M.R., Moze, O., Algarabel, P.A., Arnaudas, J.I., Abell, J.S., Del Moral, A., (1988) J. Phys. C, 21, p. 2735. , JPSOAW 0022-3719Griffiths, R.B., (1969) Phys. Rev., 188, p. 942. , PHRVAO 0031-899X 10.1103/PhysRev.188.942Dekker, A.J., (1965) J. Appl. Phys., 36, p. 906. , JAPIAU 0021-8979 10.1063/1.1714260Von Ranke, P.J., Pecharsky, V.K., Gschneidner Jr., K.A., (1998) Phys. Rev. B, 58, p. 12110. , PRBMDO 0163-1829 10.1103/PhysRevB.58.12110Christen, M., (1980) Solid State Commun., 36, p. 571. , SSCOA4 0038-1098Sablik, M.J., Pureur, P., Creuzet, G., Fert, A., Levy, P.M., (1983) Phys. Rev. B, 28, p. 3890. , PRBMDO 0163-1829 10.1103/PhysRevB.28.3890Furrer, A., Purwins, H.G., (1977) Phys. Rev. B, 16, p. 2131. , PLRBAQ 0556-2805 10.1103/PhysRevB.16.2131Tsai, T.H., Sellmyer, D.J., (1979) Phys. Rev. B, 20, p. 4577. , PRBMDO 0163-1829 10.1103/PhysRevB.20.4577Milchberg, H.M., Freeman, R.R., Davey, S.C., More, R.M., (1988) Phys. Rev. Lett., 61, p. 2364. , PRLTAO 0031-9007 10.1103/PhysRevLett.61.2364Rawat, R., Das, I., (2001) J. Phys.: Condens. Matter, 13, p. 379. , JCOMEL 0953-8984 10.1088/0953-8984/13/19/104Das, I., Rawat, R., (2000) Solid State Commun., 115, p. 207. , SSCOA4 0038-1098Xiong, C.M., Sun, J.R., Chen, Y.F., Shen, B.G., Du, J., Li, Y.X., (2005) IEEE Trans. Magn., 41, p. 122. , IEMGAQ 0018-946

Topological distribution of reversible and non reversible degradation in perovskite solar cells

Lead halide perovskites have recently raised as an easy to process and cost effective photovoltaic material. However, stability issues have to be addressed to meet the market need for 25 years durable technology. The stability of the perovskite itself, as well as the stability of the perovskite embedded in a complete device under real working conditions, are a key challenge for perovskite solar cells. Within this study, we used Photoconductive Atomic Force Microscopy pcAFM and Photoluminescence imaging PL to investigate at the nanoscale level the degradation of the perovskite film under light and voltage stress. Then, we correlate the nanoscale pcAFM and PL analysis to the macroscopic device behaviour in similar ageing condition. We found that non reversible performance losses in a complete device originate from degradation localised at the grain boundaries of the perovskite film. Interesting, within the bulk of the perovskite grains we observed fully reversible behaviours. We conclude that the grain boundaries are detrimental to the device stability and they need to be minimized or passivated to achieve fully stable perovskite solar cells even under anhydrous condition

Allosteric Inhibitors of the NS3 Protease from the Hepatitis C Virus

The nonstructural protein 3 (NS3) from the hepatitis C virus processes the non-structural region of the viral precursor polyprotein in infected hepatic cells. The NS3 protease activity has been considered a target for drug development since its identification two decades ago. Although specific inhibitors have been approved for clinical therapy very recently, resistance-associated mutations have already been reported for those drugs, compromising their long-term efficacy. Therefore, there is an urgent need for new anti-HCV agents with low susceptibility to resistance-associated mutations. Regarding NS3 protease, two strategies have been followed: competitive inhibitors blocking the active site and allosteric inhibitors blocking the binding of the accessory viral protein NS4A. In this work we exploit the intrinsic Zn+2-regulated plasticity of the protease to identify a new type of allosteric inhibitors. In the absence of Zn+2, the NS3 protease adopts a partially-folded inactive conformation. We found ligands binding to the Zn+2-free NS3 protease, trap the inactive protein, and block the viral life cycle. The efficacy of these compounds has been confirmed in replicon cell assays. Importantly, direct calorimetric assays reveal a low impact of known resistance-associated mutations, and enzymatic assays provide a direct evidence of their inhibitory activity. They constitute new low molecular-weight scaffolds for further optimization and provide several advantages: 1) new inhibition mechanism simultaneously blocking substrate and cofactor interactions in a non-competitive fashion, appropriate for combination therapy; 2) low impact of known resistance-associated mutations; 3) inhibition of NS4A binding, thus blocking its several effects on NS3 protease

Pyothorax in a cat managed by intrathoracic debridement and postoperative ventilatory support

<p/> <p>A domestic-longhair cat presented due to lethargy, dyspnoea and hypersalivation. Radiographic examination revealed a bilateral pleural effusion, which was diagnosed as pyothorax based on cytological examination. Ultrasonographic examination revealed extensive loculations within the thoracic cavity. Exploratory sternotomy, under general anaesthesia, allowed the removal of approximately 100 ml of purulent fluid and debridement of a partially walled-off abscess and necrotic material from the pleural cavity. Postoperative positive-pressure ventilation was required due to severe respiratory depression. Intensive postoperative care, including intensive continuous monitoring, thoracostomy tube drainage and lavage of the pleural cavity and oesophagostomy tube feeding, was performed. Complete resolution of clinical signs had occurred by 15 days postoperatively. Clinical or radiographic abnormalities were not detected at a follow-up examination one year after surgery.</p

Exploring the origin of high optical absorption in conjugated polymers

Vezie, Michelle S. et al.The specific optical absorption of an organic semiconductor is critical to the performance of organic optoelectronic devices. For example, higher light-harvesting efficiency can lead to higher photocurrent in solar cells that are limited by sub-optimal electrical transport. Here, we compared over 40 conjugated polymers, and found that many different chemical structures share an apparent maximum in their extinction coefficients. However, a diketopyrrolopyrrole-thienothiophene copolymer shows remarkably high optical absorption at relatively low photon energies. By investigating its backbone structure and conformation with measurements and quantum chemical calculations, we find that the high optical absorption can be explained by the high persistence length of the polymer. Accordingly, we demonstrate high absorption in other polymers with high theoretical persistence length. Visible light harvesting may be enhanced in other conjugated polymers through judicious design of the structure.M.S.V. and S. F. are grateful to the Engineering and Physical Sciences Research Council (EPSRC) for a doctoral training award and a CDT studentship (EP/G037515/1) respectively. G.P. and S.C.H. acknowledge the University of Cyprus for funding through the internal grant "ORGANIC". B.D., A.G. and M.C.Q. acknowledge financial support from the Ministerio de Economía y Competitividad of Spain through projects CSD2010–00044 (Consolider NANOTHERM), SEV-2015_0496 and MAT2012–37776 and the European Research Council through project ERC CoG648901. I.M., R.S.A. and I.McC. acknowledge support from the European Commission FP7 Project ArtESun (604397). J.N. is grateful to the Royal Society for a Wolfson Merit Award, and acknowledges financial support from EPSRC grants EP/K030671/1, EP/K029843/1 and EP/J017361/1. The authors thank Dr. Isabel Alonso for performing supplementary ellipsometric measurements; we thank Prof. Thomas Kirchartz, Dr. Jarvist Moore Frost, Dr. Christian Müller and Dr. Isabel Alonso for helpful discussions.Peer reviewe

Deconvolution analysis for classifying gastric adenocarcinoma patients based on differential scanning calorimetry serum thermograms

Recently, differential scanning calorimetry (DSC) has been acknowledged as a novel tool for diagnosing and monitoring several diseases. This highly sensitive technique has been traditionally used to study thermally induced protein folding/unfolding transitions. In previous research papers, DSC profiles from blood samples of patients were analyzed and they exhibited marked differences in the thermal denaturation profile. Thus, we investigated the use of this novel technology in blood serum samples from 25 healthy subjects and 30 patients with gastric adenocarcinoma (GAC) at different stages of tumor development with a new multiparametric approach. The analysis of the calorimetric profiles of blood serum from GAC patients allowed us to discriminate three stages of cancer development (I to III) from those of healthy individuals. After a multiparametric analysis, a classification of blood serum DSC parameters from patients with GAC is proposed. Certain parameters exhibited significant differences (P < 0.05) and allowed the discrimination of healthy subjects/patients from patients at different tumor stages. The results of this work validate DSC as a novel technique for GAC patient classification and staging, and offer new graphical tools and value ranges for the acquired parameters in order to discriminate healthy from diseased subjects with increased disease burden

Spatial arrangement of LD motif-interacting residues on focal adhesion targeting domain of Focal Adhesion Kinase determine domain-motif interaction affinity and specificity

Background: Leucine rich Aspartate motifs (LD motifs) are molecular recognition motifs on Paxillin that recognize LD-motif binding domains (LDBD) of a number of focal adhesion proteins in order to carry out downstream signaling and actin cytoskeleton remodeling. In this study, we identified structural features within LDBDs that influence their binding affinity with Paxillin LD motifs. Methods: Various point mutants of focal adhesion targeting (FAT) domain of Focal Adhesion Kinase (FAK) were created by moving a key Lysine residue two and three helical turns in order to match the unique conformations as observed in LDBDs of two other focal adhesion proteins, Vinculin and CCM3. Results: This led to identify a mutant of FAT domain of FAK, named as FAT(NV) (Asn992 of FAT domain was replaced by Val), with remarkable high affinity for LD1 (Kd = 1.5 µM vs no-binding with wild type) and LD2 peptides (Kd = 7.2 µM vs 63 µM with wild type). Consistently, the focal adhesions of MCF7 cells expressing FAK(NV) were highly stable (turnover rate = 1.25 × 10-5 µm2/s) as compared to wild type FAK transfected cells (turnover rate = 1.5 × 10-3 µm2/s). Conclusions: We observed that the relative disposition of key LD binding amino-acids at LDBD surface, hydrophobic burial of long Leucine side chains of LD-motifs and complementarity of charged surfaces are the key factors determining the binding affinities of LD motifs with LDBDs. General significance: Our study will help in protein engineering of FAT domain of FAK by modulating FAK-LD motif interactions which have implications in cellular focal adhesions and cell migration

Analysis of the Equilibrium Distribution of Ligands in Heterogeneous Media–Approaches and Pitfalls

The equilibrium distribution of small molecules (ligands) between binding agents in heterogeneous media is an important property that determines their activity. Heterogeneous systems containing proteins and lipid membranes are particularly relevant due to their prevalence in biological systems, and their importance to ligand distribution, which, in turn, is crucial to ligand’s availability and biological activity. In this work, we review several approaches and formalisms for the analysis of the equilibrium distribution of ligands in the presence of proteins, lipid membranes, or both. Special attention is given to common pitfalls in the analysis, with the establishment of the validity limits for the distinct approaches. Due to its widespread use, special attention is given to the characterization of ligand binding through the analysis of Stern–Volmer plots of protein fluorescence quenching. Systems of increasing complexity are considered, from proteins with single to multiple binding sites, from ligands interacting with proteins only to biomembranes containing lipid bilayers and membrane proteins. A new formalism is proposed, in which ligand binding is treated as a partition process, while considering the saturation of protein binding sites. This formalism is particularly useful for the characterization of interaction with membrane proteins