1,832 research outputs found

    The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

    Get PDF
    Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

    Evaluation of wood basic density as an indirect measurement of the volume of wood raw material

    Get PDF
    The manufacturing process of wood agglomerate integrates distinct unit that transforms wood raw material into wood agglomerate. The yield of wood agglomerate produced is influenced by the density and the quality of the initial raw material. This work has compared two distinct methodologies aimed at defining the yield of the process through an indirect measurement at the precursor material. Samples (logs of differentiated sizes) were collected immediately at the industry entrance and several parameters were measured. The logs basic density and the moisture content was annotated, through analysis of the corresponding dry and wet mass. Log bark percentage has estimated also at the level of dry and wet basis. These parameters were used to determine the wood volume from different provenance and species in the beginning of the industrial process. The results indicated that wasn’t a great difference between the two different methods to determine the wood basic density and the wood volume in m3. Principal components analysis was used to investigate the differences between different provenances and different species for the wood basic density, and we conclude there is a great variability in wood basic density for the hardwood species than the observed for the softwood and there isn’t a great variability between different provenances. We study too the difference off wood moisture that could be occurring before the evaluation of wood basic density

    Factors associated with post-arrest withdrawal of life-sustaining therapy.

    Get PDF
    INTRODUCTION: Most successfully resuscitated cardiac arrest patients do not survive to hospital discharge. Many have withdrawal of life sustaining therapy (WLST) as a result of the perception of poor neurologic prognosis. The characteristics of these patients and differences in their post-arrest care are largely unknown. METHODS: Utilizing the Penn Alliance for Therapeutic Hypothermia Registry, we identified a cohort of 1311 post-arrest patients from 26 hospitals from 2010 to 2014 who remained comatose after return of spontaneous circulation. We stratified patients by whether they had WLST post-arrest and analyzed demographic, arrest, and post-arrest variables. RESULTS: In our cohort, 565 (43%) patients had WLST. In multivariate regression, patients who had WLST were less likely to go to the cardiac catheterization lab (OR 0.40; 95% CI: 0.26-0.62) and had shorter hospital stays (OR 0.93; 95% CI: 0.91-0.95). When multivariate regression was limited to patient demographics and arrest characteristics, patients with WLST were older (OR 1.18; 95% CI: 1.07-1.31 by decade), had a longer arrest duration (OR 1.14; 95% CI: 1.05-1.25 per 10min), more likely to be female (OR: 1.41; 95% CI: 1.01-1.96), and less likely to have a witnessed arrest (OR 0.65; 95% CI: 0.42-0.98). CONCLUSION: Patients with WLST differ in terms of demographic, arrest, and post-arrest characteristics and treatments from those who did not have WLST. Failure to account for this variability could affect both clinical practice and the interpretation of research

    Inter-rater reliability of post-arrest cerebral performance category (CPC) scores.

    Get PDF
    PURPOSE: Cerebral Performance Category (CPC) scores are often an outcome measure for post-arrest neurologic function, collected worldwide to compare performance, evaluate therapies, and formulate recommendations. At most institutions, no formal training is offered in their determination, potentially leading to misclassification. MATERIALS AND METHODS: We identified 171 patients at 2 hospitals between 5/10/2005 and 8/31/2012 with two CPC scores at hospital discharge recorded independently - in an in-house quality improvement database and as part of a national registry. Scores were abstracted retrospectively from the same electronic medical record by two separate non-clinical researchers. These scores were compared to assess inter-rater reliability and stratified based on whether the score was concordant or discordant among reviewers to determine factors related to discordance. RESULTS: Thirty-nine CPC scores (22.8%) were discordant (kappa: 0.66), indicating substantial agreement. When dichotomized into favorable neurologic outcome (CPC 1-2)/ unfavorable neurologic outcome (CPC 3-5), 20 (11.7%) scores were discordant (kappa: 0.70), also indicating substantial agreement. Patients discharged home (as opposed to nursing/other care facility) and patients with suspected cardiac etiology of arrest were statistically more likely to have concordant scores. For the quality improvement database, patients with discordant scores had a statistically higher median CPC score than those with concordant scores. The registry had statistically lower median CPC score (CPC 1) than the quality improvement database (CPC 2); p\u3c0.01 for statistical significance. CONCLUSIONS: CPC scores have substantial inter-rater reliability, which is reduced in patients who have worse outcomes, have a non-cardiac etiology of arrest, and are discharged to a location other than home

    Validation of an ICD code for accurately identifying emergency department patients who suffer an out-of-hospital cardiac arrest.

    Get PDF
    AIM: International classification of disease (ICD-9) code 427.5 (cardiac arrest) is utilized to identify cohorts of patients who suffer out-of-hospital cardiac arrest (OHCA), though the use of ICD codes for this purpose has never been formally validated. We sought to validate the utility of ICD-9 code 427.5 by identifying patients admitted from the emergency department (ED) after OHCA. METHODS: Adult visits to a single ED between January 2007 and July 2012 were retrospectively examined and a keyword search of the electronic medical record (EMR) was used to identify patients. Cardiac arrest was confirmed; and ICD-9 information and location of return of spontaneous circulation (ROSC) were collected. Separately, the EMR was searched for patients who received ICD-9 code 427.5. The kappa coefficient (κ) was calculated, as was the sensitivity and specificity of the code for identifying OHCA. RESULTS: The keyword search identified 1717 patients, of which 385 suffered OHCA and 333 were assigned the code 427.5. The agreement between ICD-9 code and cardiac arrest was excellent (κ = 0.895). The ICD-9 code 427.5 was both specific (99.4%) and sensitive (86.5%). Of the 52 cardiac arrests that were not identified by ICD-9 code, 33% had ROSC before arrival to the ED. When searching independently on ICD-9 code, 347 patients with ICD-9 code 427.5 were found, of which 320 were true arrests. This yielded a positive predictive value of 92% for ICD-9 code 427.5 in predicting OHCA. CONCLUSIONS: ICD-9 code 427.5 is sensitive and specific for identifying ED patients who suffer OHCA with a positive predictive value of 92%

    Right ventricular dysfunction after resuscitation predicts poor outcomes in cardiac arrest patients independent of left ventricular function.

    Get PDF
    OBJECTIVE: Determination of clinical outcomes following resuscitation from cardiac arrest remains elusive in the immediate post-arrest period. Echocardiographic assessment shortly after resuscitation has largely focused on left ventricular (LV) function. We aimed to determine whether post-arrest right ventricular (RV) dysfunction predicts worse survival and poor neurologic outcome in cardiac arrest patients, independent of LV dysfunction. METHODS: A single-center, retrospective cohort study at a tertiary care university hospital participating in the Penn Alliance for Therapeutic Hypothermia (PATH) Registry between 2000 and 2012. PATIENTS: 291 in- and out-of-hospital adult cardiac arrest patients at the University of Pennsylvania who had return of spontaneous circulation (ROSC) and post-arrest echocardiograms. MEASUREMENTS AND MAIN RESULTS: Of the 291 patients, 57% were male, with a mean age of 59 ± 16 years. 179 (63%) patients had LV dysfunction, 173 (59%) had RV dysfunction, and 124 (44%) had biventricular dysfunction on the initial post-arrest echocardiogram. Independent of LV function, RV dysfunction was predictive of worse survival (mild or moderate: OR 0.51, CI 0.26-0.99, p CONCLUSIONS: Echocardiographic findings of post-arrest RV dysfunction were equally prevalent as LV dysfunction. RV dysfunction was significantly predictive of worse outcomes in post-arrest patients after accounting for LV dysfunction. Post-arrest RV dysfunction may be useful for risk stratification and management in this high-mortality population

    Comparative cytogenetic study of three Macrolophus species (Heteroptera, Miridae.)

    Get PDF
    Macrolophus pygmaeus (Rambur, 1839) (Insecta, Heteroptera, Miridae) is a predator of key vegetable crop pests applied as a biocontrol agent in the Mediterranean region. M. pygmaeus and M. melanotoma (A. Costa, 1853) are cryptic species with great morphological similarity which results in their misidentification and negative consequences for the conservation of their populations on greenhouse and outdoor crops. In order to find out specific markers for their separation we studied the karyotype, male meiosis and heterochromatin composition of these species and additionally of a third species (as a reference one), M. costalis Fieber, 1858. We demonstrate here that all the three species share achiasmate male meiosis and sex chromosome pre-reduction. On the other hand, the species differ in karyotype, with 2n=28 (26+XY) in M. pygmaeus, 2n=27 (24+X1X2Y) in M. costalis, and 2n=34 (32+XY) in M. melanotoma, and heterochromatin distribution and composition. In addition, the species differ in sperm morphology: sperm cells of M. costalis are significantly longer with longer head and tail than those of M. melanotoma and M. pygmaeus, whereas sperm cells of M. melanotoma have a longer tail than those of M. pygmaeus. All these characters can be used as markers to identify the species, in particular the cryptic species M. melanotoma and M. pygmaeus.This study has been funded by the Spanish Ministry of Economy and Competitiveness (MINECO) (Project AGL2011-24349), and by a travel grant from the University of Lleida - Fundació “La Caixa” to Dr Grozeva. The chromosome analysis was performed using microscope Axio Scope A1 – Carl Zeiss Microscopy upgraded by the project WETLANET (FP7 CSA – SUPPORT ACTION, GA 229802). We thank cordially Prof. Dr V. Kuznetsova for the valuable advices to improve the manuscrip

    Optically induced coherent intra-band dynamics in disordered semiconductors

    Full text link
    On the basis of a tight-binding model for a strongly disordered semiconductor with correlated conduction- and valence band disorder a new coherent dynamical intra-band effect is analyzed. For systems that are excited by two, specially designed ultrashort light-pulse sequences delayed by tau relatively to each other echo-like phenomena are predicted to occur. In addition to the inter-band photon echo which shows up at exactly t=2*tau relative to the first pulse, the system responds with two spontaneous intra-band current pulses preceding and following the appearance of the photon echo. The temporal splitting depends on the electron-hole mass ratio. Calculating the population relaxation rate due to Coulomb scattering, it is concluded that the predicted new dynamical effect should be experimentally observable in an interacting and strongly disordered system, such as the Quantum-Coulomb-Glass.Comment: to be published in Physical Review B15 February 200
    corecore