Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Impact of alpha-tocopherol deficiency and supplementation on sacrocaudalis and gluteal muscle fiber histopathology and morphology in horses.

BackgroundA subset of horses deficient in alpha-tocopherol (α-TP) develop muscle atrophy and vitamin E-responsive myopathy (VEM) characterized by mitochondrial alterations in the sacrocaudalis dorsalis medialis muscle (SC).ObjectivesTo quantify muscle histopathologic abnormalities in subclinical α-TP deficient horses before and after α-TP supplementation and compare with retrospective (r)VEM cases.AnimalsProspective study; 16 healthy α-TP-deficient Quarter Horses. Retrospective study; 10 retrospective vitamin E-responsive myopathy (rVEM) cases .MethodsBlood, SC, and gluteus medius (GM) biopsy specimens were obtained before (day 0) and 56 days after 5000 IU/450 kg horse/day PO water dispersible liquid α-TP (n = 8) or control (n = 8). Muscle fiber morphology and mitochondrial alterations were compared in samples from days 0 and 56 and in rVEM cases.ResultsMitochondrial alterations more common than our reference range (<2.5% affected fibers) were present in 3/8 control and 4/8 treatment horses on day 0 in SC but not in GM (mean, 2.2; range, 0%-10% of fibers). Supplementation with α-TP for 56 days did not change the percentage of fibers with mitochondrial alterations or anguloid atrophy, or fiber size in GM or SC. Clinical rVEM horses had significantly more mitochondrial alterations (rVEM SC, 13% ± 7%; GM, 3% ± 2%) and anguloid atrophy compared to subclinical day 0 horses.Conclusions and clinical importanceClinically normal α-TP-deficient horses can have mitochondrial alterations in the SC that are less severe than in atrophied VEM cases and do not resolve after 56 days of α-TP supplementation. Preventing α-TP deficiency may be of long-term importance for mitochondrial viability

Prescribing Prevalence of Medications With Potential Genotype-Guided Dosing in Pediatric Patients

Importance: Genotype-guided prescribing in pediatrics could prevent adverse drug reactions and improve therapeutic response. Clinical pharmacogenetic implementation guidelines are available for many medications commonly prescribed to children. Frequencies of medication prescription and actionable genotypes (genotypes where a prescribing change may be indicated) inform the potential value of pharmacogenetic implementation. Objective: To assess potential opportunities for genotype-guided prescribing in pediatric populations among multiple health systems by examining the prevalence of prescriptions for each drug with the highest level of evidence (Clinical Pharmacogenetics Implementation Consortium level A) and estimating the prevalence of potential actionable prescribing decisions. Design, setting, and participants: This serial cross-sectional study of prescribing prevalences in 16 health systems included electronic health records data from pediatric inpatient and outpatient encounters from January 1, 2011, to December 31, 2017. The health systems included academic medical centers with free-standing children's hospitals and community hospitals that were part of an adult health care system. Participants included approximately 2.9 million patients younger than 21 years observed per year. Data were analyzed from June 5, 2018, to April 14, 2020. Exposures: Prescription of 38 level A medications based on electronic health records. Main outcomes and measures: Annual prevalence of level A medication prescribing and estimated actionable exposures, calculated by combining estimated site-year prevalences across sites with each site weighted equally. Results: Data from approximately 2.9 million pediatric patients (median age, 8 [interquartile range, 2-16] years; 50.7% female, 62.3% White) were analyzed for a typical calendar year. The annual prescribing prevalence of at least 1 level A drug ranged from 7987 to 10 629 per 100 000 patients with increasing trends from 2011 to 2014. The most prescribed level A drug was the antiemetic ondansetron (annual prevalence of exposure, 8107 [95% CI, 8077-8137] per 100 000 children). Among commonly prescribed opioids, annual prevalence per 100 000 patients was 295 (95% CI, 273-317) for tramadol, 571 (95% CI, 557-586) for codeine, and 2116 (95% CI, 2097-2135) for oxycodone. The antidepressants citalopram, escitalopram, and amitriptyline were also commonly prescribed (annual prevalence, approximately 250 per 100 000 patients for each). Estimated prevalences of actionable exposures were highest for oxycodone and ondansetron (>300 per 100 000 patients annually). CYP2D6 and CYP2C19 substrates were more frequently prescribed than medications influenced by other genes. Conclusions and relevance: These findings suggest that opportunities for pharmacogenetic implementation among pediatric patients in the US are abundant. As expected, the greatest opportunity exists with implementing CYP2D6 and CYP2C19 pharmacogenetic guidance for commonly prescribed antiemetics, analgesics, and antidepressants

Prevalence, associated factors and outcomes of pressure injuries in adult intensive care unit patients: the DecubICUs study

Funder: European Society of Intensive Care Medicine; doi: http://dx.doi.org/10.13039/501100013347Funder: Flemish Society for Critical Care NursesAbstract: Purpose: Intensive care unit (ICU) patients are particularly susceptible to developing pressure injuries. Epidemiologic data is however unavailable. We aimed to provide an international picture of the extent of pressure injuries and factors associated with ICU-acquired pressure injuries in adult ICU patients. Methods: International 1-day point-prevalence study; follow-up for outcome assessment until hospital discharge (maximum 12 weeks). Factors associated with ICU-acquired pressure injury and hospital mortality were assessed by generalised linear mixed-effects regression analysis. Results: Data from 13,254 patients in 1117 ICUs (90 countries) revealed 6747 pressure injuries; 3997 (59.2%) were ICU-acquired. Overall prevalence was 26.6% (95% confidence interval [CI] 25.9–27.3). ICU-acquired prevalence was 16.2% (95% CI 15.6–16.8). Sacrum (37%) and heels (19.5%) were most affected. Factors independently associated with ICU-acquired pressure injuries were older age, male sex, being underweight, emergency surgery, higher Simplified Acute Physiology Score II, Braden score 3 days, comorbidities (chronic obstructive pulmonary disease, immunodeficiency), organ support (renal replacement, mechanical ventilation on ICU admission), and being in a low or lower-middle income-economy. Gradually increasing associations with mortality were identified for increasing severity of pressure injury: stage I (odds ratio [OR] 1.5; 95% CI 1.2–1.8), stage II (OR 1.6; 95% CI 1.4–1.9), and stage III or worse (OR 2.8; 95% CI 2.3–3.3). Conclusion: Pressure injuries are common in adult ICU patients. ICU-acquired pressure injuries are associated with mainly intrinsic factors and mortality. Optimal care standards, increased awareness, appropriate resource allocation, and further research into optimal prevention are pivotal to tackle this important patient safety threat

Correction to: Prevalence, associated factors and outcomes of pressure injuries in adult intensive care unit patients: the DecubICUs study

The original version of this article unfortunately contained a mistake

Prevalence, associated factors and outcomes of pressure injuries in adult intensive care unit patients: the DecubICUs study

Funder: European Society of Intensive Care Medicine; doi: http://dx.doi.org/10.13039/501100013347Funder: Flemish Society for Critical Care NursesAbstract: Purpose: Intensive care unit (ICU) patients are particularly susceptible to developing pressure injuries. Epidemiologic data is however unavailable. We aimed to provide an international picture of the extent of pressure injuries and factors associated with ICU-acquired pressure injuries in adult ICU patients. Methods: International 1-day point-prevalence study; follow-up for outcome assessment until hospital discharge (maximum 12 weeks). Factors associated with ICU-acquired pressure injury and hospital mortality were assessed by generalised linear mixed-effects regression analysis. Results: Data from 13,254 patients in 1117 ICUs (90 countries) revealed 6747 pressure injuries; 3997 (59.2%) were ICU-acquired. Overall prevalence was 26.6% (95% confidence interval [CI] 25.9–27.3). ICU-acquired prevalence was 16.2% (95% CI 15.6–16.8). Sacrum (37%) and heels (19.5%) were most affected. Factors independently associated with ICU-acquired pressure injuries were older age, male sex, being underweight, emergency surgery, higher Simplified Acute Physiology Score II, Braden score 3 days, comorbidities (chronic obstructive pulmonary disease, immunodeficiency), organ support (renal replacement, mechanical ventilation on ICU admission), and being in a low or lower-middle income-economy. Gradually increasing associations with mortality were identified for increasing severity of pressure injury: stage I (odds ratio [OR] 1.5; 95% CI 1.2–1.8), stage II (OR 1.6; 95% CI 1.4–1.9), and stage III or worse (OR 2.8; 95% CI 2.3–3.3). Conclusion: Pressure injuries are common in adult ICU patients. ICU-acquired pressure injuries are associated with mainly intrinsic factors and mortality. Optimal care standards, increased awareness, appropriate resource allocation, and further research into optimal prevention are pivotal to tackle this important patient safety threat

Clinical and Molecular Insights into Gastrointestinal Dysfunction in Myotonic Dystrophy Types 1 & 2

Myotonic dystrophy (DM) is a highly variable, multisystemic disorder that clinically affects one in 8000 individuals. While research has predominantly focused on the symptoms and pathological mechanisms affecting striated muscle and brain, DM patient surveys have identified a high prevalence for gastrointestinal (GI) symptoms amongst affected individuals. Clinical studies have identified chronic and progressive dysfunction of the esophagus, stomach, liver and gallbladder, small and large intestine, and rectum and anal sphincters. Despite the high incidence of GI dysmotility in DM, little is known regarding the pathological mechanisms leading to GI dysfunction. In this review, we summarize results from clinical and molecular analyses of GI dysfunction in both genetic forms of DM, DM type 1 (DM1) and DM type 2 (DM2). Based on current knowledge of DM primary pathological mechanisms in other affected tissues and GI tissue studies, we suggest that misregulation of alternative splicing in smooth muscle resulting from the dysregulation of RNA binding proteins muscleblind-like and CUGBP-elav-like is likely to contribute to GI dysfunction in DM. We propose that a combinatorial approach using clinical and molecular analysis of DM GI tissues and model organisms that recapitulate DM GI manifestations will provide important insight into defects impacting DM GI motility

Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses

Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses