41 research outputs found
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe
The Nuclear Receptor LXR Limits Bacterial Infection of Host Macrophages through a Mechanism that Impacts Cellular NAD Metabolism
Macrophages exert potent effector functions against invading microorganisms but constitute, paradoxically, a preferential niche for many bacterial strains to replicate. Using a model of infection by Salmonella Typhimurium, we have identified a molecular mechanism regulated by the nuclear receptor LXR that limits infection of host macrophages through transcriptional activation of the multifunctional enzyme CD38. LXR agonists reduced the intracellular levels of NAD+ in a CD38-dependent manner, counteracting pathogen-induced changes in macrophage morphology and the distribution of the F-actin cytoskeleton and reducing the capability of non-opsonized Salmonella to infect macrophages. Remarkably, pharmacological treatment with an LXR agonist ameliorated clinical signs associated with Salmonella infection in vivo, and these effects were dependent on CD38 expression in bone-marrow-derived cells. Altogether, this work reveals an unappreciated role for CD38 in bacterial-host cell interaction that can be pharmacologically exploited by activation of the LXR pathway
High Hepatitis B Prevalence and Vaccination Needs Among Transgender Women and Men Sex Workers in Barcelona, Spain
Background. Transgender women sex workers (TWSWs) and men sex workers (MSWs) are especially vulnerable to acquiring hepatitis B virus (HBV) infection. We aimed to describe HBV prevalence (hepatitis B surface antigen [HBsAg] and core antibody [HBcAb]) and associated risk factors for HBV exposure (HBcAb), to assess vaccination status and risk factors for no prior vaccination, and to compare HBV prevalence and vaccination status between TWSWs and MSWs. Methods. The SexCohort study was advertised to TWSWs and MSWs through several communication channels. At cohort entry through 2 community-based organizations in Barcelona, the study population was screened for HBV and other sexually transmitted infections, and an epidemiological questionnaire was administered (n = 271). Results. Overall, 93.0% of participants were migrants, mostly from South and Central American countries. HBsAg prevalence was 1.9% (TWSWs, 2.4%; vs MSWs, 0.9%; P = .42), and previous exposure to HBV was 31.8% (TWSWs, 38.5%; vs MSWs, 20.8%; P = .002). Over 5 years of sex work (adjusted odds ratio [aOR], 9.35), prior exposure to Treponema pallidum (aOR, 3.49), and treatment with anxiolytic drugs (aOR, 3.23) were associated with HBV exposure. Overall, 33.7% of participants exhibited immunity from vaccination (TWSWs, 30.8%; vs MSWs, 38.61%; P < .001), while 34.4% were candidates to HBV vaccination (TWSWs, 30.8%; vs MSWs, 40.6%; P < .001). Never having been on pre-exposure prophylaxis for HIV (odds ratio [OR], 4.23) and non-Spanish origin (OR, 5.00) were associated with no prior HBV vaccination. Conclusions. There is a need to reinforce screening and vaccination programs aimed at TWSWs and MSWs as integrated services offered at the community centers commonly accessed by these populations
The biogenesis and characterization of mammalian microRNAs of mirtron origin
Mirtrons, short hairpin pre-microRNA (miRNA) mimics directly produced by intronic splicing, have recently been identified and experimentally confirmed in invertebrates. While there is evidence to suggest several mammalian miRNAs have mirtron origins, this has yet to be experimentally demonstrated. Here, we characterize the biogenesis of mammalian mirtrons by ectopic expression of splicing-dependent mirtron precursors. The putative mirtrons hsa-miR-877, hsa-miR-1226 and mmu-miR-1224 were designed as introns within eGFP. Correct splicing and function of these sequences as introns was shown through eGFP fluorescence and RT–PCR, while all mirtrons suppressed perfectly complementary luciferase reporter targets to levels similar to that of corresponding independently expressed pre-miRNA controls. Splicing-deficient mutants and disruption of key steps in miRNA biogenesis demonstrated that mirtron-mediated gene knockdown was splicing-dependent, Drosha-independent and had variable dependence on RNAi pathway elements following pre-miRNA formation. The silencing effect of hsa-miR-877 was further demonstrated to be mediated by the generation of short anti-sense RNA species expressed with low abundance. Finally, the mammalian mirtron hsa-miR-877 was shown to reduce mRNA levels of an endogenous transcript containing hsa-miR-877 target sites in neuronal SH-SY5Y cells. This work confirms the mirtron origins of three mammalian miRNAs and suggests that they are a functional class of splicing-dependent miRNAs which are physiologically active
High-affinity RNA binding by a hyperthermophilic single-stranded DNA-binding protein
Single-stranded DNA-binding proteins (SSBs), including replication protein A (RPA) in eukaryotes, play a central role in DNA replication, recombination, and repair. SSBs utilise an oligonucleotide/oligosaccharide-binding (OB) fold domain to bind DNA, and typically oligomerise in solution to bring multiple OB fold domains together in the functional SSB. SSBs from hyperthermophilic crenarchaea, such as Sulfolobus solfataricus, have an unusual structure with a single OB fold coupled to a flexible C-terminal tail. The OB fold resembles those in RPA, whilst the tail is reminiscent of bacterial SSBs and mediates interaction with other proteins. One paradigm in the field is that SSBs bind specifically to ssDNA and much less strongly to RNA, ensuring that their functions are restricted to DNA metabolism. Here, we use a combination of biochemical and biophysical approaches to demonstrate that the binding properties of S. solfataricus SSB are essentially identical for ssDNA and ssRNA. These features may represent an adaptation to a hyperthermophilic lifestyle, where DNA and RNA damage is a more frequent event.Publisher PDFPeer reviewe
The Complete Genome Sequence of Thermoproteus tenax: A Physiologically Versatile Member of the Crenarchaeota
Here, we report on the complete genome sequence of the hyperthermophilic Crenarchaeum Thermoproteus tenax (strain Kra 1, DSM 2078(T)) a type strain of the crenarchaeotal order Thermoproteales. Its circular 1.84-megabase genome harbors no extrachromosomal elements and 2,051 open reading frames are identified, covering 90.6% of the complete sequence, which represents a high coding density. Derived from the gene content, T. tenax is a representative member of the Crenarchaeota. The organism is strictly anaerobic and sulfur-dependent with optimal growth at 86 degrees C and pH 5.6. One particular feature is the great metabolic versatility, which is not accompanied by a distinct increase of genome size or information density as compared to other Crenarchaeota. T. tenax is able to grow chemolithoautotrophically (CO2/H-2) as well as chemoorganoheterotrophically in presence of various organic substrates. All pathways for synthesizing the 20 proteinogenic amino acids are present. In addition, two presumably complete gene sets for NADH:quinone oxidoreductase (complex I) were identified in the genome and there is evidence that either NADH or reduced ferredoxin might serve as electron donor. Beside the typical archaeal A(0)A(1)-ATP synthase, a membrane-bound pyrophosphatase is found, which might contribute to energy conservation. Surprisingly, all genes required for dissimilatory sulfate reduction are present, which is confirmed by growth experiments. Mentionable is furthermore, the presence of two proteins (ParA family ATPase, actin-like protein) that might be involved in cell division in Thermoproteales, where the ESCRT system is absent, and of genes involved in genetic competence (DprA, ComF) that is so far unique within Archaea
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.</p
Displacement of the canonical single-stranded DNA-binding protein in the Thermoproteales
Single-stranded DNA binding proteins (SSBs) based on the OB-fold are considered ubiquitous in nature and play a central role in many DNA transactions including replication, recombination and repair. We demonstrate that the thermoproteales, a clade of hyperthermophilic crenarchaea, lack a canonical SSB. Instead, they encode a distinct ssDNA-binding protein that we term "ThermoDBP", exemplified by protein Ttx1576 from Thermoproteus tenax. ThermoDBP binds specifically to ssDNA with low sequence specificity. The crystal structure of Ttx1576 reveals a unique fold and mechanism for ssDNA binding, consisting of an extended cleft lined with hydrophobic phenylalanine residues and flanked by basic amino acids. Two ssDNA-binding domains are linked by a coiled-coil leucine zipper. ThermoDBP appears to have displaced the canonical SSB during the diversification of the thermoproteales – a highly unusual example where a “ubiquitous” protein has been lost in evolution.PostprintPeer reviewe