146 research outputs found
Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae
The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution
Structure of the periplasmic adaptor protein from a major facilitator superfamily (MFS) multidrug efflux pump.
Periplasmic adaptor proteins are key components of bacterial tripartite efflux pumps. The 2.85 Å resolution structure of an MFS (major facilitator superfamily) pump adaptor, Aquifex aeolicus EmrA, shows linearly arranged α-helical coiled-coil, lipoyl, and β-barrel domains, but lacks the fourth membrane-proximal domain shown in other pumps to interact with the inner membrane transporter. The adaptor α-hairpin, which binds outer membrane TolC, is exceptionally long at 127 Å, and the β-barrel contains a conserved disordered loop. The structure extends the view of adaptors as flexible, modular components that mediate diverse pump assembly, and suggests that in MFS tripartite pumps a hexamer of adaptors could provide a periplasmic seal.This work was supported by grants from the UK Medical Research Council and The Wellcome Trust to C.H. and V.KThis is the advanced access version of the article, distributed under a Creative Commons Attribution License. It can also be found on the publisher's website at: http://www.sciencedirect.com/science/article/pii/S0014579314005195
THE PROBLEM OF THE RELATIONSHIP OF SCIENCE AND RELIGION IN THE SYSTEM OF SECULAR GENERAL EDUCATION
The relationship between science and religion throughout history ranged from opposition to their unity. The long-standing prevalence of theology over science has caused a counter-atheistic reaction, which has grown into the absolutization of science in all spheres of life. The introduction to the secular general education of the course “Fundamentals of Religious Cultures and Secular Ethics” was ambiguously accepted by society. The author substantiates the position that science and religion are not mutually exclusive, but rather can complement each other, forming a unified picture of the world among the younger generation.Взаимоотношения науки и религии на протяжении всей истории выстраивались от противопоставления до их единства. Многолетнее преобладание богословия над наукой вызвало встречную атеистическую реакцию, переросшую в абсолютизацию науки во всех сферах бытия. Введение в светское общее образование курса «Основы религиозных культур и светской этики» было неоднозначно воспринято обществом. Автор обосновывает позицию, что наука и религия не взаимно исключают друг друга, а напротив, могут дополнять друг друга, формируя у подрастающего поколения единую картину мира
Recommended from our members
RsmA, RsmC and FlhDC regulate sdhEygfX in Serratia
SdhE is required for the flavinylation and activation of succinate dehydrogenase and fumarate reductase (FRD). In addition, SdhE is conserved in proteobacteria (α, β and γ) and eukaryotes. Although the function of this recently characterized family of proteins has been determined, almost nothing is known about how their genes are regulated. Here, the RsmA (CsrA) and RsmC (HexY) post-transcriptional and post-translational regulators have been identified and shown to repress sdhEygfX expression in Serratia sp. ATCC 39006. Conversely, the flagella master regulator complex, FlhDC, activated sdhEygfX transcription. To investigate the hierarchy of control, we developed a novel approach that utilized endogenous CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR associated) genome-editing by a type I-F system to generate a chromosomal point mutation in flhC. Mutation of flhC alleviated the ability of RsmC to repress sdhEygfX expression, whereas RsmA acted in both an FlhDC-dependent and -independent manner to inhibit sdhEygfX. Mutation of rsmA or rsmC, or overexpression of FlhDC, led to increased prodigiosin, biosurfactant, swimming and swarming. Consistent with the modulation of sdhE by motility regulators, we have demonstrated that SdhE and FRD are required for maximal flagella-dependent swimming. Together, these results demonstrate that regulators of both metabolism and motility (RsmA, RsmC and FlhDC) control the transcription of the sdhEygfX operon.This work was supported by the Marsden Fund, Royal Society of New Zealand (RSNZ) to PCF and a Strategic Grant from the Otago School of Medical Sciences (OSMS) to MB. HGH was supported by a University of Otago Doctoral Scholarship, MBM by a Division of Health Sciences Career Development Post-doctoral Fellowship, BN by a Dean's Prestigious Summer Scholarship from the OSMS and PCF was supported by a Rutherford Discovery Fellowship (RSNZ). NRW and GPCS were supported by Biotechnology and Biological Sciences Research Council (BBSRC), UK awards to the GPCS laboratory. We thank members of the Fineran and Cook laboratories for helpful discussions, Tim Blower for plasmid pTRB32 and for critically reading the manuscript.This is the final version of the article. It first appeared from the Microbiology Society via http://dx.doi.org/10.1099/mic.0.00028
Exploring and Expanding the Fatty-Acid-Binding Protein Superfamily in Fasciola Species
The liver flukes Fasciola hepatica and F. gigantica infect livestock worldwide and threaten food security with climate change and problematic control measures spreading disease. Fascioliasis is also a food borne disease with up to 17 million humans infected. In the absence of vaccines, treatment depends on Triclabendazole (TCBZ) and over-use has led to widespread resistance, compromising future TCBZ control. Reductionist biology from many laboratories has predicted new therapeutic targets. To this end, the fatty acid binding protein (FABP) superfamily have proposed multi-functional roles, including functions intersecting vaccine and drug therapy, such as immune modulation and anthelmintic sequestration. Research is hindered by a lack of understanding of the full FABP superfamily complement. Although discovery studies predicted FABPs as promising vaccine candidates, it is unclear if uncharacterised FABPs are more relevant for vaccine formulations. We have coupled genome, transcriptome and EST data mining with proteomics and phylogenetics, to reveal a liver fluke FABP superfamily of 7 clades: previously identified clades I-III and newly identified clades IV-VII. All new clade FABPs were analysed using bioinformatics and cloned from both liver flukes. The extended FABP dataset will provide new study tools to research the role of FABPs in parasite biology and as therapy targets
Mathematics difficulties in extremely preterm children : evidence of a specific deficit in basic mathematics processing
Background:
Extremely preterm (EP, <26 wk gestation) children have been observed to have poor academic achievement in comparison to their term-born peers, especially in mathematics. This study investigated potential underlying causes of this difficulty.
Methods:
A total of 219 EP participants were compared with 153 term-born control children at 11 y of age. All children were assessed by a psychologist on a battery of standardized cognitive tests and a number estimation test assessing children’s numerical representations.
Results:
EP children underperformed in all tests in comparison with the term controls (the majority of Ps < 0.001). Different underlying relationships between performance on the number estimation test and mathematical achievement were found in EP as compared with control children. That is, even after controlling for cognitive ability, a relationship between number representations and mathematical performance persisted for EP children only (EP: r = 0.346, n = 186, P < 0.001; control: r = 0.095, n = 146, P = 0.256).
Conclusion:
Interventions for EP children may target improving children’s numerical representations in order to subsequently remediate their mathematical skills
Recommended from our members
Ruthenium polypyridyl complex bound to a unimolecular chair-form G-quadruplex
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, con-sistent with its transient formation in live cells. The stabilisation of a particular topology by a small molecule is of great importance for therapeutic applications. Here we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays en-antiospecific G-quadruplex binding. It crystallised in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterised example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a compar-ative ligand binding study, we showed, using a Klenow fragment assay, that the title complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work
Environmental change: prospects for conservation and agriculture in a southwest Australia biodiversity hotspot
Accelerating environmental change is perhaps the greatest challenge for natural resource management; successful
strategies need to be effective for decades to come. Our objective is to identify opportunities that new environmental conditions may provide for conservation, restoration, and resource use in a globally recognized biodiversity hotspot in southwestern Australia. We
describe a variety of changes to key taxonomic groups and system-scale characteristics as a consequence of environmental change (climate and land use), and outline strategies for conserving and restoring important ecological and agricultural characteristics. Opportunities for conservation and economic adaptation are substantial because of gradients in rainfall, temperature, and land use,
extensive areas of remnant native vegetation, the ability to reduce and ameliorate areas affected by secondary salinization, and the existence of large national parks and an extensive network of nature reserves. Opportunities presented by the predicted environmental changes encompass agricultural as well as natural ecosystems. These may include expansion of aquaculture, transformation of
agricultural systems to adapt to drier autumns and winters, and potential increases in spring and summer rain, carbon-offset plantings, and improving the network of conservation reserves. A central management dilemma is whether restoration/preservation efforts should have a commercial or biodiversity focus, and how they could be integrated. Although the grand challenge is conserving, protecting,
restoring, and managing for a future environment, one that balances economic, social, and environmental values, the ultimate goal is to establish a regional culture that values the unique regional environment and balances the utilization of natural resources against protecting remaining natural ecosystems
Keeping calm in the face of change: towards optimisation of FRP by reasoning about change
Functional Reactive Programming (FRP) is an approach to reactive programming where systems are structured as networks of functions operating on signals (time-varying values). FRP is based on the synchronous data-flow paradigm and supports both (an approximation to) continuous-time and discrete-time signals (hybrid systems).What sets FRP apart from most other languages for similar applications is its support for systems with dynamic structure and for higher-order reactive constructs. This paper contributes towards advancing the state of the art of FRP implementation by studying the notion of signal change and change propagation in a setting of structurally dynamic networks of n-ary signal functions operating on mixed continuous-time and discrete-time signals. We first define an ideal denotational semantics (time is truly continuous) for this kind of FRP, along with temporal properties, expressed in temporal logic, of signals and signal functions pertaining to change and change propagation. Using this framework, we then show how to reason about change; specifically, we identify and justify a number of possible optimisations, such as avoiding recomputation of unchanging values. Note that due to structural dynamism, and the fact that the output of a signal function may change because time is passing even if the input is unchanging, the problem is significantly more complex than standard change propagation in networks with static structure
- …