An anatomical study of the propriospinal connections in the cat

In the spinal cord the neuronal cell bodies are located in the spinal gray matter, which may be subdivided into a dorsal horn, a ventral horn and an intermediate zone. Neurons in the dorsal horn give rise mainly to long ascending fibers, while the motoneurons of the ventral horn innervate the musculature of body and limbs. The intermediate zone harbours the majority of propriospinal neurons, which differ from other spinal neurons in that not only their cell bodies, but also their terminal axonal projections are located within the spinal gray matter

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

Band - Weg interactie

De huidige infrastructuur van wegen waarover men zich snel en comfortabel kan verplaatsen is niet meer weg te denken uit onze maatschappij. Twee “componenten” die hierbij een belangrijke rol spelen zijn het wegdek en de band. Het contact tussen band en wegdek is mede bepalend voor de veiligheid. De rolweerstand beïnvloedt het brandstofverbruik en dus de uitstoot van uitlaatgassen. De mechanische eigenschappen en geometrie van het wegdek en de band bepalen de geluidproductie (verkeersgeluid) maar ook de mate van slijtage van beide componenten (fijn stof). Er wordt onderzoek gedaan om de veiligheid, de rolweerstand, de duurzaamheid e.d. van banden en wegdek te verbeteren. In veel gevallen wordt dit door de bandenindustrie en de wegdekproducenten afzonderlijk gedaan. Op deze manier streeft men er naar om te komen tot een optimale band en een optimaal wegdek. Maar wat optimaal is voor de band hoeft nog niet optimaal voor het wegdek te zijn. Vandaar dat voor een echt optimale combinatie van band en wegdek, onderzoek moet worden gedaan naar de gekoppelde situatie of wel naar band-weg interactie. Om dit te realiseren hebben 4 onderzoeksgroepen van de Universiteit Twente met ervaring op het gebied van wegdekken of banden de krachten gebundeld teneinde band-wegdek interactie (modelmatig en experimenteel) integraal te kunnen onderzoeke

Physiological responses to folate overproduction in lactobacillys plantarum WCFS1.

<p>Abstract</p> <p>Background</p> <p>Using a functional genomics approach we addressed the impact of folate overproduction on metabolite formation and gene expression in <it>Lactobacillus plantarum </it>WCFS1. We focused specifically on the mechanism that reduces growth rates in folate-overproducing cells.</p> <p>Results</p> <p>Metabolite formation and gene expression were determined in a folate-overproducing- and wild-type strain. Differential metabolomics analysis of intracellular metabolite pools indicated that the pool sizes of 18 metabolites differed significantly between these strains. The gene expression profile was determined for both strains in pH-regulated chemostat culture and batch culture. Apart from the expected overexpression of the 6 genes of the folate gene cluster, no other genes were found to be differentially expressed both in continuous and batch cultures. The discrepancy between the low transcriptome and metabolome response and the 25% growth rate reduction of the folate overproducing strain was further investigated. Folate production per se could be ruled out as a contributing factor, since in the absence of folate production the growth rate of the overproducer was also reduced by 25%. The higher metabolic costs for DNA and RNA biosynthesis in the folate overproducing strain were also ruled out. However, it was demonstrated that folate-specific mRNAs and proteins constitute 8% and 4% of the total mRNA and protein pool, respectively.</p> <p>Conclusion</p> <p>Folate overproduction leads to very little change in metabolite levels or overall transcript profile, while at the same time the growth rate is reduced drastically. This shows that <it>Lactobacillus plantarum </it>WCFS1 is unable to respond to this growth rate reduction, most likely because the growth-related transcripts and proteins are diluted by the enormous amount of gratuitous folate-related transcripts and proteins.</p

Netinnovatie Kottervisserij

Als reactie op de aanlandplicht heeft de kottersector via de Coöperatieve Visserij Organisatie (CVO) het initiatief opgepakt om de selectiviteit van de vistuigen te verhogen om zo weinig mogelijk discards te vangen en aan te landen. Na een ontwerpfase met modelonderzoek in de flume tank van SINTEF te Hirtshals, Denemarken, en met ervaringen uit eerdere projecten werden op verscheidene schepen netinnovaties uitgeprobeerd. Er werd onderzoek gedaan op een schip met boomkor, verschillende schepen vissend met pulsvistuigen en op twinriggers. Hierbij werd aanvankelijk gewerkt op ‘trial-and error’ basis met in sommige gevallen zelfmonitoring. Vervolgens werden enkele uitgebreide vangst- en bijvangstvergelijkingen gedaan met medewerkers van IMARES aan boord

Complement Split Product C5a Mediates the Lipopolysaccharide‐Induced Mobilization of Cfu‐S and Haemopoietic Progenitor Cells, But Not the Mobilization Induced By Proteolytic Enzymes

Abstract. Intravenous (i.v.) injection of mice with lipopolysaccharide (LPS), and the proteolytic enzymes trypsin and proteinase, mobilizes pluripotent haemopoietic stem cells (CFU‐s) as well as granulocyte‐macrophage progenitor cells (GM‐CFU) and the early progenitors of the erythroid lineage (E‐BFU) from the haemopoietic tissues into the peripheral blood. We investigated the involvement of the complement (C) system in this process. It appeared that the early mobilization induced by LPS and other activators of the alternative complement pathway, such as Listeria monocytogenes (Lm) and zymosan, but not that induced by the proteolytic enzymes, was absent in C5‐deficient mice. the mobilization by C activators in these mice could be restored by injection of C5‐sufficient serum, suggesting a critical role for C5. The manner in which C5 was involved in the C activation‐mediated stem cell mobilization was studied using a serum transfer system. C5‐sufficient serum, activated in vitro by incubation with Lm and subsequently liberated from the bacteria, caused mobilization in both C5‐sufficient and C5‐deficient mice. C5‐deficient serum was not able to do so. the resistance of the mobilizing principle to heat treatment (56°C, 30 min) strongly suggests that it is identical with the C5 split product C5a, or an in vivo derivative of C5a. This conclusion was reinforced by the observation that a single injection of purified rat C5a into C5‐deficient mice also induced mobilization of CFU‐s. Copyrigh