1,429 research outputs found
Compact coalgebras, compact quantum groups and the positive antipode
In this article -that has also the intention to survey some known results in
the theory of compact quantum groups using methods different from the standard
and with a strong algebraic flavor- we consider compact o-coalgebras and Hopf
algebras. In the case of a o-Hopf algebra we present a proof of the
characterization of the compactness in terms of the existence of a positive
definite integral, and use our methods to give an elementary proof of the
uniqueness - up to conjugation by an automorphism of Hopf algebras- of the
compact involution appearing in [4]. We study the basic properties of the
positive square root of the antipode square that is a Hopf algebra automorphism
that we call the positive antipode. We use it -as well as the unitary antipode
and the Nakayama automorphism- in order to enhance our understanding of the
antipode itself
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe
A simple tool to forecast the natural frequencies of thin-walled cylinders
This paper presents an approximate method to predict the natural frequencies of thinwalled cylinders. By taking inspiration from a previous work of one of the authors, the starting point of the proposed approach is a proper construction of reasonable eigenfunctions. However, a new simple tool based on the principle of virtual work has been developed to estimate the natural frequencies and the amplitude of vibration without complex numerical resolution. Moreover, the applicability of the model is extended to all the most common constraint conditions. The identification of the natural frequencies of a continuous cylinder is reduced to an eigenvalue problem based on a matrix whose elements depend only on the geometric characteristics of the cylinder, the mechanical properties of the material and known numerical parameters. The latter are precalculated for given boundary conditions, covering clamped or pinned end constraints. Although the proposed formulation can address any constraints combination, only a pinned-pinned cylinder is analyzed here for brevity. The reliability of the model was tested against FEM analysis results. These comparisons showed that the maximum error versus the exact solutions for the lowest natural frequency is around 2% for all the mode shapes of the pinned-pinned case, offering an excellent trade-off between accuracy and ease of use
Effects of Ponderosa Pine Ecological Restoration on Forest Soils and Understory Vegetation in Northern Arizona
The human exclusion of wildfire and overgrazing by livestock since settlement have caused dramatic changes in ponderosa pine (Pinus ponderosa Dougl ex Laws) forest ecosystems. These changes include increased numbers of tree stems, reduced understory cover and diversity, and the introduction of invasive, non-native understory species. This study evaluated the coverage and species composition of understory vegetation present in the “cool-season” (late spring and early summer) in a ponderosa pine forest on grazed and ungrazed plots that had undergone restoration treatments on three different soil/geologic parent material types near Flagstaff, Arizona, twelve years after tree thinning and grazing exclosure treatments were applied. Several measured soil properties, such as soil respiration and temperature, were also evaluated in this study. Species richness of “cool-season” vegetation was influenced more by grazing practices than restoration treatments. Differences could be less or greater when vegetation that is active later in the season is measured. Vegetative cover was significantly influenced by restoration treatments (9.3% cover under open canopies and 6.5% under dense canopies), probably due to differences in competition for light and other resources (i.e. soil moisture and nutrients). Unlike finding by Abella et al. (2015), who studied “warm-season” vegetation, “cool-season” understory cover was not influenced by soil parent material type in this study, which might suggest that differences in understory cover due to soil properties are only seen shortly after restoration treatments are applied, or the time of year vegetation is evaluated may play a role in the differences seen. Soil respiration was highest on limestone soil parent material type (3.3 g C-CO2 m-2 day-1), and soil temperature was lowest under closed canopy treatments (15°C)
Validation of an ICD code for accurately identifying emergency department patients who suffer an out-of-hospital cardiac arrest.
AIM: International classification of disease (ICD-9) code 427.5 (cardiac arrest) is utilized to identify cohorts of patients who suffer out-of-hospital cardiac arrest (OHCA), though the use of ICD codes for this purpose has never been formally validated. We sought to validate the utility of ICD-9 code 427.5 by identifying patients admitted from the emergency department (ED) after OHCA.
METHODS: Adult visits to a single ED between January 2007 and July 2012 were retrospectively examined and a keyword search of the electronic medical record (EMR) was used to identify patients. Cardiac arrest was confirmed; and ICD-9 information and location of return of spontaneous circulation (ROSC) were collected. Separately, the EMR was searched for patients who received ICD-9 code 427.5. The kappa coefficient (κ) was calculated, as was the sensitivity and specificity of the code for identifying OHCA.
RESULTS: The keyword search identified 1717 patients, of which 385 suffered OHCA and 333 were assigned the code 427.5. The agreement between ICD-9 code and cardiac arrest was excellent (κ = 0.895). The ICD-9 code 427.5 was both specific (99.4%) and sensitive (86.5%). Of the 52 cardiac arrests that were not identified by ICD-9 code, 33% had ROSC before arrival to the ED. When searching independently on ICD-9 code, 347 patients with ICD-9 code 427.5 were found, of which 320 were true arrests. This yielded a positive predictive value of 92% for ICD-9 code 427.5 in predicting OHCA.
CONCLUSIONS: ICD-9 code 427.5 is sensitive and specific for identifying ED patients who suffer OHCA with a positive predictive value of 92%
A Review of the current knowledge of the crustal and lithospheric structure of the Valencia Trough Basin
In this paper, we review the current geophysical knowledge of the Valencia Trough Basin, and the surrounding areas. For this purpose, we summarize the most significant regional geophysical datasets acquired since the seventies to investigate the trough (seismic, gravity, geoid and heat flow data). We then focus on the discussion regarding the geometry and physical properties of the present day crustal and lithospheric structure derived from seismic images, as well as combined potential field modelling and their relationships with the Alpine geodynamic evolution of the Valencia Trough. Finally, we discuss the differences in the results regarding the geometry of the lithosphere-asthenosphere boundary obtained by different modelling approaches and the features that, in our view, require further investigation to unravel the true nature of the Valencia Trough, including what could have caused the differences between the crustal structure observed in the SW region compared to the NE region, the asymmetric style of thinning across the trough; the origin of the changes in the lower crustal reflectivity across the basin; the fabric of the uppermost mantle, characterized by anomalously low P-wave velocities; and the physical properties of the lithosphere mantle (density, Pwaves velocity, thermal conductivity, temperature distribution, mineralogical composition, etc.)
Assessment of microbial community structure changes by amplified ribosomal DNA restriction analysis (ARDRA)
Amplified ribosomal DNA restriction analysis (ARDRA) is a simple method based on restriction endonuclease digestion of the amplified bacterial 16S rDNA. In this study we have evaluated the suitability of this method to detect differences in activated sludge bacterial communities fed on domestic or industrial wastewater, and subject to different operational conditions. The ability of ARDRA to detect these differences has been tested in modified Ludzack-Ettinger (MLE) configurations. Samples from three activated sludge wastewater treatment plants (WWTPs) with the MLE configuration were collected for both oxic and anoxic reactors, and ARDRA patterns using double enzyme digestions AluI+MspI were obtained. A matrix of Dice similarity coefficients was calculated and used to compare these restriction patterns. Differences in the community structure due to influent characteristics and temperature could be observed, but not between the oxic and anoxic reactors of each of the three MLE configurations. Other possible applications of ARDRA for detecting and monitoring changes in activated sludge systems are also discussed
COVID-19: Open-data resources for monitoring, modeling, and forecasting the epidemic
We provide an insight into the open-data resources pertinent to the study of the spread of the Covid-19 pandemic and its control. We identify the variables required to analyze fundamental aspects like seasonal behavior, regional mortality rates, and effectiveness of government measures. Open-data resources, along with data-driven methodologies, provide many opportunities to improve the response of the different administrations to the virus. We describe the present limitations and difficulties encountered in most of the open-data resources. To facilitate the access to the main open-data portals and resources, we identify the most relevant institutions, on a global scale, providing Covid-19 information and/or auxiliary variables (demographics, mobility, etc.). We also describe several open resources to access Covid-19 datasets at a country-wide level (i.e., China, Italy, Spain, France, Germany, US, etc.). To facilitate the rapid response to the study of the seasonal behavior of Covid-19, we enumerate the main open resources in terms of weather and climate variables. We also assess the reusability of some representative open-data sources
- …