Coexistence of two main folded G-quadruplexes within a single G-rich domain in the EGFR promoter

EGFR is an oncogene which codifies for a tyrosine kinase receptor that represents an important target for anticancer therapy. Indeed, several human cancers showed an upregulation of the activity of this protein. The promoter of this gene contains some G-rich domains, thus representing a yet unexplored point of intervention to potentially silence this gene. Here, we explore the conformational equilibria of a 30-nt long sequence located at position -272 (EGFR-272). By merging spectroscopic and electrophoretic analysis performed on the wild-type sequence as well as on a wide panel of related mutants, we were able to prove that in potassium ion containing solution this sequence folds into two main G-quadruplex structures, one parallel and one hybrid. They show comparable thermal stabilities and affinities for the metal ion and, indeed, they are always co-present in solution. The folding process is driven by a hairpin occurring in the domain corresponding to the terminal loop which works as an important stabilizing element for both the identified G-quadruplex arrangements

Comparison of biochemical and morphological properties of selected tomato varieties grown in glasshouse and in field

The influence of environment on the characteristic of tomatoes was researched in the Laboratory field of the Biotechnical Faculty in Ljubljana between May and September 2012. The experiment was conducted on four different strains of tomatoes (two strains - Novosadski jabučar and Volovsko srce, and two hybrids Belle F1 and Amati F1) in a plastic greenhouse and outdoors. First, we sowed the seeds into polystyrene culture plates and transplanted the plants after they had developed 4 to 5 trophophylls. Technologically ripe fruits were picked once a week between July 10 and September 10, 2012. Simultaneously we measured the height of plants, thickness of stems, length of internodes, the number of marketable fruits per plant, an average mass of marketable fruits, a mass of marketable fruits per plant, a share of unmarketable fruits, a hardness of fruits and the thickness of pericarps. We also performed biochemical analyses and compared the colours of fruits (L*, a*, b*), sugars in fruits (total sugar, saccharose, glucose, fructose) and organic acids in fruits (citronic, shikimic, fumaric, malic acid), antioxidants in fruits (lycopene, vitamin C). We were interested in the influence of different environments on the measured parameters and how they vary between different sorts. We discovered that the plants cultivated in a protected environment develop better and grow fruits of a higher quality than those cultivated in the open air. At the same time strain specific deviations were apparent

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10\u2022C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression

Methylation of selenocysteine catalysed by thiopurine S-methyltransferase

Background: Methylation driven by thiopurine S-methylatransferase (TPMT) is crucial for deactivation of cytostatic and immunosuppressant thiopurines. Despite its remarkable integration into clinical practice, the endogenous function of TPMT is unknown. Methods: To address the role of TPMT in methylation of selenium compounds, we established the research on saturation transfer difference (STD) and 77Se NMR spectroscopy, fluorescence measurements, as well as computational molecular docking simulations. Results: Using STD NMR spectroscopy and fluorescence measurements of tryptophan residues in TPMT, we determined the binding of selenocysteine (Sec) to human recombinant TPMT. By comparing binding characteristics of Sec in the absence and in the presence of methyl donor, we confirmed S-adenosylmethionine (SAM)-induced conformational changes in TPMT. Molecular docking analysis positioned Sec into the active site of TPMT with orientation relevant for methylation reaction. Se-methylselenocysteine (MeSec), produced in the enzymatic reaction, was detected by 77Se NMR spectroscopy. A direct interaction between Sec and SAM in the active site of rTPMT and the formation of both products, MeSec and S-adenosylhomocysteine, was demonstrated using NMR spectroscopy. Conclusions: The present study provides evidence on in vitro methylation of Sec by rTPMT in a SAM-dependant manner. General significance: Our results suggest novel role of TPMT and demonstrate new insights into enzymatic modifications of the 21st amino acid

Identification and characterisation of G-quadruplex DNA-forming sequences in the Pseudomonas aeruginosa genome

We report identification and characterisation of G-quadruplex DNA forming sequences in the Pseudomonas aeruginosa genome in genes associated with antimicrobial resistance. </p

Nep1-like proteins as a target for plant pathogen control.

The lack of efficient methods to control the major diseases of crops most important to agriculture leads to huge economic losses and seriously threatens global food security. Many of the most important microbial plant pathogens, including bacteria, fungi, and oomycetes, secrete necrosis- and ethylene-inducing peptide 1 (Nep1)-like proteins (NLPs), which critically contribute to the virulence and spread of the disease. NLPs are cytotoxic to eudicot plants, as they disturb the plant plasma membrane by binding to specific plant membrane sphingolipid receptors. Their pivotal role in plant infection and broad taxonomic distribution makes NLPs a promising target for the development of novel phytopharmaceutical compounds. To identify compounds that bind to NLPs from the oomycetes Pythium aphanidermatum and Phytophthora parasitica, a library of 587 small molecules, most of which are commercially unavailable, was screened by surface plasmon resonance. Importantly, compounds that exhibited the highest affinity to NLPs were also found to inhibit NLP-mediated necrosis in tobacco leaves and Phytophthora infestans growth on potato leaves. Saturation transfer difference-nuclear magnetic resonance and molecular modelling of the most promising compound, anthranilic acid derivative, confirmed stable binding to the NLP protein, which resulted in decreased necrotic activity and reduced ion leakage from tobacco leaves. We, therefore, confirmed that NLPs are an appealing target for the development of novel phytopharmaceutical agents and strategies, which aim to directly interfere with the function of these major microbial virulence factors. The compounds identified in this study represent lead structures for further optimization and antimicrobial product development