Morphological characterization of vaginal epithelial cells of santa inês ewes subjected to estrus synchronization

Vaginal cytology analysis has been used to evaluate the different stages of estrous cycle of several species; it presents a direct correlation with the animal’s hormonal state and provides essential information about the female reproductive tract conditions. Two staining methods were tested to evaluate the vaginal epithelial cell morphology of nulliparous and multiparous ewes during the estrus period. An intravaginal device impregnated with medroxyprogesterone acetate was kept into 10 nulliparous and 10 multiparous ewes for 14 days for estrus synchronization. Then, the progesterone device was withdrawn, and 300 IU of eCG was administered intramuscularly. Vaginal smears were prepared for posterior staining with Panotico or Giemsa stains when estrus was detected. The cells were classified into nucleated superficial, anucleate superficial, intermediate, parabasal, and basal. The Panotico and Giemsa staining of the different cell types studied were satisfactory. A predominance of intermediate epithelial cells (p<0.05) was found after staining. No difference in percentages of the different types of vaginal epithelial cells between nulliparous and multiparous ewes were found. Therefore, both staining methods were efficient, and a predominance of intermediate cells is found in nulliparous and multiparous ewes during the estrus period.Vaginal cytology analysis has been used to evaluate the different stages of estrous cycle of several species; it presents a direct correlation with the animal’s hormonal state and provides essential information about the female reproductive tract conditions. Two staining methods were tested to evaluate the vaginal epithelial cell morphology of nulliparous and multiparous ewes during the estrus period. An intravaginal device impregnated with medroxyprogesterone acetate was kept into 10 nulliparous and 10 multiparous ewes for 14 days for estrus synchronization. Then, the progesterone device was withdrawn, and 300 IU of eCG was administered intramuscularly. Vaginal smears were prepared for posterior staining with Panotico or Giemsa stains when estrus was detected. The cells were classified into nucleated superficial, anucleate superficial, intermediate, parabasal, and basal. The Panotico and Giemsa staining of the different cell types studied were satisfactory. A predominance of intermediate epithelial cells (p<0.05) was found after staining. No difference in percentages of the different types of vaginal epithelial cells between nulliparous and multiparous ewes were found. Therefore, both staining methods were efficient, and a predominance of intermediate cells is found in nulliparous and multiparous ewes during the estrus period

EFEITO DO RESVERATROL ASSOCIADO A SACAROSE EM PROTOCOLO DE VITRIFICAÇÃO DE TECIDO OVARIANO DE VACAS

The objective of this work was to evaluate the effect of the association of the antioxidant resveratrol with sucrose in a vitrification protocol of ovarian tissue in cows, on the morphology of preantral follicles. Ten ovaries of cows were used, collected in local slaughterhouses, fragmented and distributed to the following treatments: fresh control (Co); toxicity (T); (T0) zero toxicity/ only with base vitrification solution (SBV), (TS) toxicity with SBV plus sucrose, (TR) toxicity with SBV plus resveratrol, (TS+R) toxicity with SBV and sucrose plus resveratrol; and for glazing (V); (VS) vitrification with SBV and sucrose, (VR) vitrification with SBV and resveratrol, (VS+R) vitrification with SBV and sucrose plus resveratrol. Preantral follicles were quantified and classified according to morphology into normal and degenerated. The mean percentages between normal and degenerated follicles did not differ (p>0.05) in the following percentages, normal 51.4% and degenerated 48.60%. In the toxicity test there was a difference (p<0.05) between the fresh control and the toxicity treatments, however regarding the vitrification treatments there was no difference (p>0.05), demonstrating that the vitrification technique is efficient, but the concentration of cryoprotectants used needs to be re-evaluated. Concluding that the natural antioxidant association resveratrol to sucrose in vitrification and rewarming protocols contributes with reservations for the morphological preservation of preantral follicles in cows.The objective of this work was to evaluate the effect of the association of the antioxidant resveratrol with sucrose in a vitrification protocol of ovarian tissue in cows, on the morphology of preantral follicles. Ten ovaries of cows were used, collected in local slaughterhouses, fragmented and distributed to the following treatments: fresh control (Co); toxicity (T); (T0) zero toxicity/ only with base vitrification solution (SBV), (TS) toxicity with SBV plus sucrose, (TR) toxicity with SBV plus resveratrol, (TS+R) toxicity with SBV and sucrose plus resveratrol; and for glazing (V); (VS) vitrification with SBV and sucrose, (VR) vitrification with SBV and resveratrol, (VS+R) vitrification with SBV and sucrose plus resveratrol. Preantral follicles were quantified and classified according to morphology into normal and degenerated. The mean percentages between normal and degenerated follicles did not differ (p>0.05) in the following percentages, normal 51.4% and degenerated 48.60%. In the toxicity test there was a difference (p<0.05) between the fresh control and the toxicity treatments, however regarding the vitrification treatments there was no difference (p>0.05), demonstrating that the vitrification technique is efficient, but the concentration of cryoprotectants used needs to be re-evaluated. Concluding that the natural antioxidant association resveratrol to sucrose in vitrification and rewarming protocols contributes with reservations for the morphological preservation of preantral follicles in cows

Avaliação (biometria) de testículos de ovinos criados em Araguaína-To região da Amazônia legal / Evaluation (biometry) of testicles of sheep raised in Araguaína-To legal Amazon region

O Brasil concentra o 18º maior rebanho de ovinos, em 2013, a produção mundial de carne ovina alcançou 8,6 milhões de toneladas (CNA, 2016). Araguaína é a segunda cidade com o maior rebanho efetivo no estado do Tocantins, com 4.473 cabeças (IBGE, 2015). O presente estudo foi realizado no setor de ovinocultura da Escola de Medicina Veterinária e Zootecnia-UFT (EMVZ/UFT), no município de Araguaína - Tocantins região da Amazônia Legal. Foram utilizados 16 machos ovino Sem Raça Definida (SRD) com idade de 06 a 36 meses pesando de 16 a 71kg, mestiços da raça Santa Inês, criados em sistema semi-intensivo. O grupo de maiores médias de peso foi o grupo em que se obtiveram maiores médias de comprimento, largura e perímetro com diferenças entre eles altamente significativo (p<0,05). A biometria testicular mostrou-se um adequado indicador do desenvolvimento testicular de fácil execução, e é possível predizer da capacidade reprodutiva de um macho e determinar alterações patológicas sugestivas devido às alterações de tamanhos.

Confecção de peças anatômicas a partir da clonagem de órgãos reais utilizando materiais sintéticos de baixo custo / Construction of anatomical parts from the cloning of real organs using low cost synthetic materials

A anatomia é uma disciplina de fundamental importância para diversos cursos da área da saúde e tem seu ensino tradicionalmente relacionado a confecção de peças anatômicas a partir de cadáveres. Entretanto, essa abordagem tem se mostrado cada vez mais insuficiente diante de questões éticas que prezam pela substituição ou redução do uso de animais mortos para atividades didáticas, assim como por reduzir o uso e descartes dos produtos químicos essenciais para confecção e conservação de peças anatômicas de origem animal. Desta forma, o presente estudo objetivou desenvolver um protocolo para confecção de peças anatômicas de forma artesanal, utilizando materiais de baixo custo. Para tanto foi formulada uma solução contendo água, glicerina bidestilada e gelatina incolor, na qual a peça anatômica a ser clonada (terceiro osso do carpo equino) foi imersa. Após duas horas sob refrigeração em freezer convencional houve a polimerização da solução, permitindo o corte para a remoção da peça anatômica original, mas mantendo um molde. Em seguida, o molde foi preenchido com uma solução composta por gesso em pó e água. Com auxílio de nova refrigeração foi notado o enrijecimento completo do gesso. Após ser retirado do molde, foi observado um “clone” da peça anatômica original, com destaque para as características morfológicas, incluindo a manutenção das superfícies articulares. Em conclusão, a peça a anatômica replicada “clone” apresentou elevada similaridade quando comparado com peças reais. Portanto, o protocolo desenvolvido neste estudo mostrou-se viável para a obtenção de modelos anatômicos ósseos tridimensionais constituindo assim uma alternativa para a obtenção de peças sintéticas a baixo custo e isentas de dilemas éticos relacionados ao uso de animais em práticas de ensino. 

ASSOCIAÇÃO ENTRE HORMÔNIO ANTI-MÜLLERIANO E POPULAÇÃO FOLICULAR OVARIANA: UMA REVISÃO SISTEMÁTICA

Anti-Müllerian hormone (AMH) has gained increasing interest as a biomarker of ovarian follicular reserve. Therefore, the present study aims to present a systematic review of recent findings related to AMH, with emphasis on its role as a biomarker of ovarian follicular reserve in different domestic species. For that, searches were carried out in databases of scientific electronic libraries, in search of articles that addressed the present theme. The studies found were analyzed and submitted to inclusion and exclusion criteria that allowed the selection of those that met the objectives of the present study. In total, 69 publications were found. Of these, 15 met the established criteria and were used as the basis for this study. The results of this systematic review demonstrate that the measurement of serum levels of AMH in association with the population of antral follicles (FPA) is a promising parameter to estimate the reproductive potential of different domestic females. However, due to the lack of validation in large herds and the absence of reliable predictive values for each species, the potential of AMH is still underutilized.La hormona antimülleriana (AMH) ha ganado un interés creciente como biomarcador de la reserva folicular ovárica. Por lo tanto, el presente estudio tiene como objetivo presentar una revisión sistemática de los hallazgos recientes relacionados con la AMH, con énfasis en su papel como biomarcador de la reserva folicular ovárica en diferentes especies domésticas. Para eso, se realizaron búsquedas en bases de datos de bibliotecas científicas electrónicas, en busca de artículos que abordaran la presente temática. Los estudios encontrados fueron analizados y sometidos a criterios de inclusión y exclusión que permitieron seleccionar aquellos que cumplieron con los objetivos del presente estudio. En total, se encontraron 69 publicaciones. De estos, 15 cumplieron con los criterios establecidos y se utilizaron como base para este estudio. Los resultados de esta revisión sistemática demuestran que la medición de los niveles séricos de AMH en asociación con la población de folículos antrales (FPA) es un parámetro prometedor para estimar el potencial reproductivo de diferentes hembras domésticas. Sin embargo, debido a la falta de validación en grandes manadas y la ausencia de valores predictivos confiables para cada especie, el potencial de AMH aún está infrautilizado.O hormônio Anti-Mülleriano (AMH) tem ganhado interesse crescente como um biomarcador da reserva folicular ovariana. Portanto, o presente estudo tem como objetivo apresentar uma revisão sistemática sobre os achados recentes relacionados ao AMH, com ênfase no seu papel como biomarcador da reserva folicular ovariana em diferentes espécies domésticas. Para tanto, foram realizadas pesquisas em bases de dados de bibliotecas eletrônicas científicas, em busca de artigos que abordassem a presente temática. Os estudos encontrados foram analisados e submetidos a critérios de inclusão e exclusão que permitiram realizar a seleção daqueles que atendiam aos objetivos do presente estudo. No total, foram encontradas 69 publicações. Destas, 15 estavam de acordo com os critérios estabelecidos e foram utilizadas para o embasamento deste estudo. Os resultados desta revisão sistemática demonstram que a dosagem dos níveis séricos de AMH em associação com a população de folículos antrais (PFA) constitui um parâmetro promissor para estimar o potencial reprodutivo de diferentes fêmeas domésticas. Entretanto, devido à falta de validação em grandes rebanhos e ausência de valores preditivos confiáveis para cada espécie, o potencial do AMH ainda é subutilizado

ANÁLISE ECONÔMICA SOBRE O MANEJO NUTRICIONAL E SANITÁRIO EM CRIAÇÕES DE OVINOS NAS PROPRIEDADES DO SUL DE TOCANTINS

With the objective of analyzing the impact of the nutritional and sanitary manages bioeconomically in properties of the South of the State of Tocantins, through productivity indices, it accomplished a survey, through questionnaire, in 12 properties, of the which, it was selected intentionally six, that it were divided in two groups: group "A", containing three properties that accomplish appropriate nutritional and sanitarium manages; and group "B", also with three properties whose nutritional and sanitarium manages are deficient. After completion of the questionnaire, for gauging of the productivity indices of each group, it can be glimpsed the magnitude of the impact of the nutritional and sanitary manages on the systems of creation of animals sheep, demonstrating that the properties of the group "A", in spite of the expenses with feeding and medicines, it possess more competitive and lucrative profile in relation to the group "B". Of ownership of the data of the indexes productivity, it took place an evolution of a flock, containing 100 ewes and three reproductive, where the group "A" presented a larger number of animals to be sloughtered, proving the profitability of the systems that use an appropriate nutritional and sanitarium manages rationally

Detecção de Leptospira pomona em sêmen bovino por eletroforese capilar fluorescente

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomona diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona (10 0 to 10 7 bacteria/ ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2 % agarose gel, silver staining 8% polyacrylamide gel and fluorescent capillary electrophoresis. The detection limit of capillary electrophoresis for Leptospira pomona was 10 2bacteria/ml. Under UV light, in 2 % agarose gel, the detection limit was of 10 4 bacteria/ ml while for silver stained 8 % polyacrylamide gel it was 10 2 bacteria/ ml. PCR with fluorescent capillary electrophoresis is an efficient and rapid diagnostic test for DNA detection of Leptospira in bovine semen and this can be an important tool for herd and semen sanitary control in artificial insemination centers

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10³ bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial

Nonlinear models for fitting growth curves of Nellore cows reared in the Amazon Biome

Growth curves of Nellore cows were estimated by comparing six nonlinear models: Brody, Logistic, two alternatives by Gompertz, Richards and Von Bertalanffy. The models were fitted to weight-age data, from birth to 750 days of age of 29,221 cows, born between 1976 and 2006 in the Brazilian states of Acre, Amapá, Amazonas, Pará, Rondônia, Roraima and Tocantins. The models were fitted by the Gauss-Newton method. The goodness of fit of the models was evaluated by using mean square error, adjusted coefficient of determination, prediction error and mean absolute error. Biological interpretation of parameters was accomplished by plotting estimated weights versus the observed weight means, instantaneous growth rate, absolute maturity rate, relative instantaneous growth rate, inflection point and magnitude of the parameters A (asymptotic weight) and K (maturing rate). The Brody and Von Bertalanffy models fitted the weight-age data but the other models did not. The average weight (A) and growth rate (K) were: 384.6±1.63 kg and 0.0022±0.00002 (Brody) and 313.40±0.70 kg and 0.0045±0.00002 (Von Bertalanffy). The Brody model provides better goodness of fit than the Von Bertalanffy model

High frequency of visceral leishmaniasis in dogs under veterinary clinical care in an intense transmission area in the state of Tocantins, Brazil

ABSTRACT: A direct search for parasites were used as the diagnostic test to determine the frequency of Leishmania spp. infection in dogs ( Canis lupus familiaris ) under veterinary clinical care in the city of Araguaína, Tocantins, Brazil. For this approach, lymph node cell samples were collected using needle aspiration from 649 dogs of different breeds and ages. Two hundred and sixty four (40.7%) dogs tested positive for amastigote forms of Leishmania spp. Furthermore, 202 (76.5%) dogs that tested positive showed some clinical sign of disease, while 62 (28.4%) dogs were asymptomatic. Dogs <2 years old or those that lived alongside poultry species in peri-domicile areas had a greater chance of infection (P<0.05). Our results revealed the importance of frequently monitoring leishmaniasis in dogs, and the need to train veterinary professionals who work in high-transmission areas on the clinical diagnosis of canine visceral leishmaniasis